Summary

RMgm-677
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0923800; Gene model (P.falciparum): PF3D7_1124500; Gene product: pyruvate dehydrogenase E1 component subunit alpha (PDH E1α; PDH-E1)
Transgene
Transgene not Plasmodium: GFP
Promoter: Gene model: PBANKA_0719300; Gene model (P.falciparum): PF3D7_0417200; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase
3'UTR: Gene model: Not available; Gene product: Not available
Replacement locus: Gene model: PBANKA_0923800; Gene product: pyruvate dehydrogenase E1 component subunit alpha (PDH E1α; PDH-E1)
Phenotype Liver stage;
Last modified: 27 March 2013, 19:47
  *RMgm-677
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22128915
Reference 2 (PMID number) : 23500072
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherC.Deschermeier; V.T. Heussler
Name Group/DepartmentInstitute of Cell Biology
Name InstituteUniversity of Bern
CityBern
CountrySwitzerland
Name of the mutant parasite
RMgm numberRMgm-677
Principal namePbΔPDH-E1
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageSee 'Additional remarks phenotype'. Partly aberrant formation of mature liver-stage schizonts
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of PDH E1α (pyruvate dehydrogenase E1 alpha subunit ) and expresses GFP.

Protein (function)
Acetyl-CoA is synthesized from pyruvate by the enzyme complex pyruvate dehydrogenase (PDH). PDH is a member of the α-ketoacid dehydrogenase multienzyme complexes and consists of three subunits: pyruvate dehydrogenase (E1), dihydrolipoyl acetyltransferase (E2) and lipoamide dehydrogenase (dihydrolipoyl dehydrogenase; E3).  Acetyl-CoA is an essential precursor of fatty acid synthesis in plastids and fuels the tricarboxylic acid (TCA) cycle in mitochondria, which generates energy in the form of ATP.
In most eukaryotes PDH localizes to the mitochondria where it converts pyruvate into acetyl-CoA and NADH that then enter the TCA cycle for complete oxidization. In plants, a second unique PDH complex is harboured by the plastid and its function is to provide acetyl-CoA for fatty acid synthesis. In Plasmodium there is no evidence for the existence of a mitochondrial PDH complex and the sole Plasmodium PDH complex is targeted to the apicoplast.

In previous studies it has been shown that apicoplast-targeted proteins include enzymes of the FAS II pathway. The presence of this pathway indicates that as well as taking up lipids from its host, Plasmodium also utilizes its own de novo fatty acid synthesis. Transcriptome and proteome analyses of Plasmodium liver stages have demonstrated the expression of apicoplast-targeted enzymes involved in FAS II in liver stages, indicating an important role of de novo FAS II in the developing liver stage. It has been shown that deletion of genes encoding FAS II elongation enzymes (i.e. FabI, FabB/F, FabZ.) caused no defects in parasite blood stage replication and mosquito stage development but livers stage development was severely reduced in the FAS II-deficient parasites.

Analyses of P. yoelii mutants lacking expression of PDH E1α (see below) indicate a non-essential role of PDH E1α for blood stages and mosquito stages but an important role during late liver stage development. Analysis of in vitro cultured liver stages showed significant defects in terms of growth and nuclear division. Disruption of  PDH E1α showed a similar phenotype to mutants lacking FAS II elongation enzymes (i.e. FabI, FabB/f; FabZ). This suggests that in Plasmodium the sole function of PDH is to provide the acetyl-CoA necessary for de novo fatty acid synthesis.

Phenotype
Phenotype analyses of these mutants are provided in the paper PMID:23500072. Phenotype analyses indicate a role of PDH-E1α in final maturation of liver-stage schizonts. See also additional information.

No details of the phenotype of these mutants are provided in the paper PMID: 22128915. The mutant has been used to provide evidence that a functional FAS-II pathway is necessary for lipoylation of proteins in the apicoplast of P. berghei liver stage parasites.

For detailed phenotype analyses of P. yoelii parasites lacking expression  PDH-E1α see the mutant RMgm-376 (and the other mutants mentioned below).

Additional information
Analyses of mutants expressing cmyc-tagged version of PDH E1α (RMgm-371)  showed no significant expression in blood stages. PHD E1α-myc expression was observed in mosquito salivary gland sporozoites and in liver stages. Evidence was presented that PDH E1α  is exclusively targeted to the apicoplast in P. yoelii.

PbΔPDH-E1 sporozoites infected and developed normally in HepG2 cells in comparison to wt parasites. The parasites formed an apparently normal PVM and reached the late liver stages, similar to what has been described for P. yoelii pdh-e1a knockout (PyΔPDH-E1) parasites. However, in contrast to PyΔPDH-E1 parasites, PbΔPDH-E1 parasites expressed the merozoite surface protein 1 (MSP1). MSP1 expression is induced briefly before merozoite development and the protein localises to the plasma membrane of late schizonts and later to that of the forming merozoites. Interestingly, although MSP1 was found in the plasma membrane of PbΔPDH-E1 schizonts, the staining pattern appeared diffuse rather than strictly membrane-associated and was additionally visible in the PVM, indicating a mis-localization during development, presumably directly or indirectly due to the lack of PDH-E1a.
the PbΔPDH-E1 parasites initially displayed an apparently normal development, a size difference was observed between the wt and mutant parasites at late liver stage development (54 h p.i).  These results show that the knockout of pdh-e1a has an influence on parasite growth only in late liver stage development but, in contrast to PyΔPDH-E1 parasites, these parasites were still able to express the merozoite marker protein, MSP1.

PbΔPDH-E1 parasites had a much less attenuated phenotype in vivo than in vitro. An injection of a moderate number of 2,000 or 5,000 PbDPDH-E1 sporozoites into BALB/c mice resulted in the development of a blood stage parasitemia in all mice, albeit with a delayed prepatency, indicating that the PbΔPDH-E1 parasites are clearly but moderately attenuated in vivo. Considering that knockout of the pdh-e1a gene in P. yoelii parasites resulted in a solid attenuation in vitro and in vivo, this result was unexpected. However, it is consistent with the fact that in vitro PbΔPDH-E1 parasites occasionally forming merozoites and detached cells.

Other mutants
RMgm-376: A P.yoelii mutant lacking expression of  PDH E1α
RMgm-371: A P.yoelii mutant expressing myc-tagged PDH E1α
RMgm-372: A P.yoelii mutant expressing myc-tagged PDH E3 (lipoamide dehydrogenase)
RMgm-377: A P.yoelii mutant lacking expression of PDH E3 (lipoamide dehydrogenase)
RMgm-378: A P.yoelii mutant lacking expression of  PDH E1α and expressing RFP under the constitutive eef1a promoter.
RMgm-379: A P.yoelii mutant lacking expression of  PDH E3 and expressing RFP under the constitutive eef1a promoter.
 


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0923800
Gene Model P. falciparum ortholog PF3D7_1124500
Gene productpyruvate dehydrogenase E1 component subunit alpha
Gene product: Alternative namePDH E1α; PDH-E1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationGenomic sequences flanking the ORF of P. berghei PDH-E1 (PBANKA_092380) were PCR amplified. Fragments were cloned into the vector pOB90 (Oliver Billker, Wellcome Trust Sanger Institute, Hinxton, Cambridge, UK) harboring a cassette mediating constitutive expression of cytosolic GFP using the restriction sites KpnI/ClaI and NotI/SacII. Genomic integration of this construct results in the replacement of a large part of the PbPDH-E1 ORF with a cassette mediating constitutive expression of the selection marker TgDHFR-TS and cytosolic GFP.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GCGGTACCTTGCCATAGTCCTCTTTGACC
Additional information primer 15' flanking region (KpnI)
Sequence Primer 2GCATCGATTGTTTGTCACCTCAATTAAGAA
Additional information primer 25' flanking region (ClaI)
Sequence Primer 3GCGCGGCCGCATAGAAGCTATTACATACAGAAC
Additional information primer 33' flanking region (NotI)
Sequence Primer 4GCCCGCGGAAGAAATTTTTAATATTATTATGG
Additional information primer 43' flanking region (SacII)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationGenomic sequences flanking the ORF of P. berghei PDH-E1 (PBANKA_092380) were PCR amplified. Fragments were cloned into the vector pOB90 (Oliver Billker, Wellcome Trust Sanger Institute, Hinxton, Cambridge, UK) harboring a cassette mediating constitutive expression of cytosolic GFP using the restriction sites KpnI/ClaI and NotI/SacII. Genomic integration of this construct results in the replacement of a large part of the PbPDH-E1 ORF with a cassette mediating constitutive expression of the selection marker TgDHFR-TS and cytosolic GFP.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0719300
Gene Model P. falciparum ortholog PF3D7_0417200
Gene productbifunctional dihydrofolate reductase-thymidylate synthase
Gene product: Alternative name
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative name
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0923800
Gene productpyruvate dehydrogenase E1 component subunit alpha
Gene product: Alternative namePDH E1α; PDH-E1
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GCGGTACCTTGCCATAGTCCTCTTTGACC
Additional information primer 15' flanking region (KpnI)
Sequence Primer 2GCATCGATTGTTTGTCACCTCAATTAAGAA
Additional information primer 25' flanking region (ClaI)
Sequence Primer 3GCGCGGCCGCATAGAAGCTATTACATACAGAAC
Additional information primer 33' flanking region (NotI)
Sequence Primer 4GCCCGCGGAAGAAATTTTTAATATTATTATGG
Additional information primer 43' flanking region (SacII)