RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-371
Malaria parasiteP. yoelii
Genotype
TaggedGene model (rodent): PY17X_0925800; Gene model (P.falciparum): PF3D7_1124500; Gene product: pyruvate dehydrogenase E1 component subunit alpha (PDH E1α)
Name tag: c-myc
Phenotype Sporozoite; Liver stage;
Last modified: 5 April 2010, 18:17
  *RMgm-371
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20059687
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone Not applicable
Other information parent line17XNL is a non-lethal strain of P. yoelii
The mutant parasite was generated by
Name PI/ResearcherY. Pei; S.H.I. Kappe
Name Group/DepartmentNot applicable
Name InstituteSeattle Biomedical Research Institute, University of Washington
CitySeattle
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-371
Principal namePDH E1α-myc
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteIFA analyses using anti-myc antibodies showed no significant expression in blood stages. PHD E1α-myc expression was observed in salivary gland sporozoites. The myc-tagged protein was localized to a small circular structure next to the nucleus. IFA analyses demonstrated the co-localization of E1α-myc with FabI, a FAS II elongation enzyme that is expressed in the apicoplast, confirming that PDH is targeted to the apicoplast.
Liver stageIn liver stages E1α-myc staining was observed at 24 hour as tadpole-shaped structures surrounding the dividing nuclei. Liver stages exhibited intensive staining at 30 and 43 hi, which coincides with the extensive expansion of the apicoplast during schizogony. At 52 hi, E1α-myc expression appeared as small dots in a similar number and size to the individual nuclei present in the developing merozoites.
Additional remarks phenotype

Mutant/mutation
The mutant  expresses a c-myc-tagged form of PDH E1α  (pyruvate dehydrogenase E1 alpha subunit ). The c-myc tagged gene is located next to the endogenous  pdh e1α gene and is expressed under control of the pdh e1α promoter region.

Protein (function)
Acetyl-CoA is synthesized from pyruvate by the enzyme complex pyruvate dehydrogenase (PDH). PDH is a member of the α-ketoacid dehydrogenase multienzyme complexes and consists of three subunits: pyruvate dehydrogenase (E1), dihydrolipoyl acetyltransferase (E2) and lipoamide dehydrogenase (dihydrolipoyl dehydrogenase; E3).  Acetyl-CoA is an essential precursor of fatty acid synthesis in plastids and fuels the tricarboxylic acid (TCA) cycle in mitochondria, which generates energy in the form of ATP.
In most eukaryotes PDH localizes to the mitochondria where it converts pyruvate into acetyl-CoA and NADH that then enter the TCA cycle for complete oxidization. In plants, a second unique PDH complex is harboured by the plastid and its function is to provide acetyl-CoA for fatty acid synthesis. In Plasmodium there is no evidence for the existence of a mitochondrial PDH complex and the sole Plasmodium PDH complex is targeted to the apicoplast.

In previous studies it has been shown that apicoplast-targeted proteins include enzymes of the FAS II pathway. The presence of this pathway indicates that as well as taking up lipids from its host, Plasmodium also utilizes its own de novo fatty acid synthesis. Transcriptome and proteome analyses of Plasmodium liver stages have demonstrated the expression of apicoplast-targeted enzymes involved in FAS II in liver stages, indicating an important role of de novo FAS II in the developing liver stage. It has been shown that deletion of genes encoding FAS II elongation enzymes (i.e. FabI, FabB/F, FabZ.) caused no defects in parasite blood stage replication and mosquito stage development but liver stage development was severely reduced in the FAS II-deficient parasites.

Phenotype analyses of mutants lacking expression of PDH E1α (RMgm-376, RMgm-378). indicate a non-essential role of PDH E1α for blood stages and mosquito stages but an important role during late liver stage development. Analysis of in vitro cultured liver stages showed significant defects in terms of growth and nuclear division. Disruption of  PDH E1α showed a similar phenotype to mutants lacking FAS II elongation enzymes (i.e. FabI, FabB/f; FabZ). This suggests that in Plasmodium the sole function of PDH is to provide the acetyl-CoA necessary for de novo fatty acid synthesis.

Phenotype
Analyses of mutants expressing cmyc-tagged version of PDH E1α (described here) and PDH E3 (RMgm-372) showed no significant expression in blood stages. PHD E1α-myc and PHD E3-myc expression was observed in mosquito salivary gland sporozoites. The myc-tagged proteins were localized to a small circular structure next to the nucleus. This localization pattern is similar to the localization of epitope-tagged FAS II elongation enzymes that are expressed in the apicoplast. To confirm apicoplast localization of E1α and E3, an antibody was generated against P. yoelii FabI to be used as an apicoplast marker. IFA analyses demonstrated the co-localization of E1α-myc and E3-myc with FabI confirming that PDH, as previously shown for P. falciparum, is exclusively targeted to the apicoplast in P. yoelii. In liver stages E1α-myc staining was observed at 24 hour as tadpole-shaped structures surrounding the dividing nuclei . The complexity of the apicoplast increased after 24 h and exhibited intensive staining at 30 and 43 hi, which coincides with the extensive expansion of the apicoplast during schizogony. At 52 hi, E1α-myc expression appeared as small dots in a similar number and size to the individual nuclei present in the developing merozoites, indicating that each mature merozoite contains an individual apicoplast. IFA analyses of liver stages of parasites expressing  PDH E3-myc showed similar expression patterns.

Additional information
Phenotype analyses of mutants lacking expression of PDH E1α (RMgm-376, RMgm-378). indicate a non-essential role of PDH E1α for blood stages and mosquito stages but an important role during late liver stage development. Analysis of in vitro cultured liver stages showed significant defects in terms of growth and nuclear division. Disruption of  PDH E1α showed a similar phenotype to mutants lacking FAS II elongation enzymes (i.e. FabI, FabB/f; FabZ). This suggests that in Plasmodium the sole function of PDH is to provide the acetyl-CoA necessary for de novo fatty acid synthesis.

Other mutants
RMgm-372: A mutant expressing myc-tagged PDH E3 (lipoamide dehydrogenase)
RMgm-376: A mutant lacking expression of  PDH E1α
RMgm-377: A mutant lacking expression of PDH E3 (lipoamide dehydrogenase)
RMgm-378: A mutant lacking expression of  PDH E1α and expressing RFP under the constitutive eef1a promoter.
RMgm-379: A mutant lacking expression of  PDH E3 and expressing RFP under the constitutive eef1a promoter.





  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PY17X_0925800
Gene Model P. falciparum ortholog PF3D7_1124500
Gene productpyruvate dehydrogenase E1 component subunit alpha
Gene product: Alternative namePDH E1α
Details of the genetic modification
Name of the tagc-myc
Details of taggingC-terminal
Additional remarks: taggingquadruple myc tag
Commercial source of tag-antibodiesSanta Cruz Biotechnology (anti-myc primary)
Invitrogen (Alexa fluor secondary)
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid NcoI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTo generate the E1α-myc transgenic parasite line, the P. yoelii PDH e1α gene without the stop codon, as well as approximately 1.5 kb upstream sequence from the start codon, was amplified by PCR from P. yoelii 17XNL genomic DNA and was cloned upstream of the quadruple myc tag in plasmid b3D-myc. The plasmid was subsequently linearized with NcoI and integrated into the P. yoelii 17XNL genome by single crossover recombination. This integration strategy created two copies of the e1α gene, which were both under the control of the endogenous promoter. One copy is the original gene and the other is the myc epitope-tagged gene.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCGCGGACCTAATCAACCAATGTTAAAATAGT
Additional information primer 1(KspI); forward
Sequence Primer 2ACTAGTGTTTATAATTAGAGGTAATTGCTT
Additional information primer 2(SpeI); Reverse
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6