Summary

RMgm-676
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0714300; Gene model (P.falciparum): PF3D7_0816500; Gene product: small heat shock protein HSP20, putative (HSP20)
Name tag: mCherry
Phenotype Asexual bloodstage; Fertilization and ookinete; Oocyst; Sporozoite; Liver stage;
Last modified: 6 March 2012, 14:28
  *RMgm-676
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22139844
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherMontagna, G.N.; Matuschewski, K.
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-676
Principal nameHSP20-mCherry
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stagemCherry signals barely detected in all blood stages
Gametocyte/GameteNot different from wild type
Fertilization and ookinetemCherry-HSP20 abundantly expressed in ookinetes
OocystmCherry-HSP20 abundantly expressed in oocysts
SporozoitemCherry-HSP20 abundantly expressed in sporozoites (see 'Additional remarks phenotype')
Liver stageSee 'Additional remarks phenotype'
Additional remarks phenotype

Mutant/mutation
The mutant expresses a mCherry-tagged version of HSP20 (small heat shock protein, HSP20).

Protein
Plasmodium HSP20 was identified by homology searches using the Toxoplasma gondii HSP20 sequence (gi: 78368731) as query. Plasmodium HSP20 contains a central α-crystallin domain (Pfam: PF00011).

Phenotype analyses of mutants lacking expression of HSP20 (RMgm-672, RMgm-675) provide evidence that HSP20 is involved in ookinete and sporozoite motility.

Phenotype
Through analysis of expression of mCherry-tagged HSP20 and using a polyclonal antiserum against HSP20 it is shown that HSP70 is abundantly expressed in ookinetes, oocysts and sporozoites (and no or very low expression in blood stages and maturing liver stages). In addition evidence is presented that HSP20 redistributes to the apical tip in motile sporozoites. In gliding sporozoites, tagged HSP20 localizes to the plasma membrane of gliding sporozoites and accumulates at the ventral side of the anterior tip and at the posterior half. The observations in addition with immuno-electron-microscopy observations suggest that HSP20 is recruited to the cortical side of the pellicle in gliding sporozoites and that this polarization of HSP20 is a molecular signature of mature, motile, and infectious sporozoites.

Additional information
Analyis of the expression of HSP20 in infected hepatoma cells with a polyclonal antiserum showed that at 4 h after hepatocyte invasion, the HSP20 signal, likely derived from the infecting sporozoite, is still clearly detectable. This signal is progressively lost from later stage parasites, being no longer detectable in mature liver stages.

Other mutants
RMgm-675, RMgm-672:  Mutants lacking expression of HSP20 (and expressing GFP).


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0714300
Gene Model P. falciparum ortholog PF3D7_0816500
Gene productsmall heat shock protein HSP20, putative
Gene product: Alternative nameHSP20
Details of the genetic modification
Name of the tagmCherry
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid PacI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationFor fusion of the red fluorescent protein mCherry to the PbHSP20 5’UTR and ORF, a 1493 bp fragment was cloned into SacII-SpeI sites of the BD3+mCherry vector. A PCR fragment corresponding to the PbHSP20 5’UTR and ORF was amplified with primers 5’UTR Hsp20 SacII (5´-TCCCCGCGGGGAGTTTAAAATTATTGCTAGTTC-3´) and Hsp20 rvSpeI (5’-
CGGACTAGTCCGTGCTTCGTTTATTTCTACTTTATGC-3’) and cloned into the SacII-SpeI sites of the BD3D+mCherry vector, resulting in the HSP20 mCherry fusion construct. This targeting plasmid was linearized with PacI.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TCCCCGCGGGGAGTTTAAAATTATTGCTAGTTC
Additional information primer 15’UTR Hsp20 SacII
Sequence Primer 2CGGACTAGTCCGTGCTTCGTTTATTTCTACTTTATGC
Additional information primer 2Hsp20 rvSpeI
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6