Summary

RMgm-672
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0714300; Gene model (P.falciparum): PF3D7_0816500; Gene product: small heat shock protein HSP20, putative (HSP20)
Transgene
Transgene not Plasmodium: GFP (gfp-mu3)
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Fertilization and ookinete; Sporozoite; Liver stage;
Last modified: 5 January 2012, 17:32
  *RMgm-672
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22139844
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 507cl1 (RMgm-7)
Other information parent lineP.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherMontagna, G.N.; Matuschewski, K.
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-672
Principal namehsp20(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal numbers of ookinetes are produced. The speed of gliding of ookinetes obtained from in vitro cultures was moderately, albeit significantly, reduced.
OocystNot different from wild type
SporozoiteNormal production of salivary gland sporozoites. Infectivity of mutant sporozoites to mice after intravenously injection is comparable to wild type sporozoites.
Infectivity of mutant sporozoites to mice after mosquito feeding is strongly reduced.
Mutant sporozoite show aberrant motility and substrate adhesion in vitro.
Mutant sporozoites showed normal host cell traversal and invasion.
Liver stageInfectivity of mutant sporozoites to mice after intravenously injection is comparable to wild type sporozoites.
Infectivity of mutant sporozoites to mice after mosquito feeding is strongly reduced.
Mutant sporozoites showed normal host cell traversal and invasion.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of  a small heat shock protein, HSP20 and expresses GFP under the control of the constitutive eef1α promoter.

Protein
Plasmodium HSP20 was identified by homology searches using the Toxoplasma gondii HSP20 sequence (gi: 78368731) as query. Plasmodium HSP20 contains a central α-crystallin domain (Pfam: PF00011).

Phenotype
Mutant ookinetes and sporozoites show reduced and or aberrant motility. Sporozoites show reduced infectivity to mice after infection by mosquito bite and not after intravenous injection. Mutant sporozoites showed normal host cell traversal and invasion. Evidence is presented that mutant sporozoites have a specific defect in fast and circular gliding motility while retaining their full capacity to breach and eventually invade target cells.

Additional information
Through analysis of expression of mCherry-tagged HSP20 (see mutant RMgm-676) and using a polyclonal antiserum against HSP20 it is shown that HSP70 is abundantly expressed in ookinetes, oocysts and sporozoites (and no or very low expression in blood stages and maturing liver stages). In addition evidence is presented that HSP20 redistributes to the apical tip in motile sporozoites. In gliding sporozoites, tagged HSP20 localizes to the plasma membrane of gliding sporozoites and accumulates at the ventral side of the anterior tip and at the posterior half. The observations in addition with immuno-electron-microscopy observations suggest that HSP20 is recruited to the cortical side of the pellicle in gliding sporozoites and that this polarization of HSP20 is a molecular signature of mature, motile, and infectious sporozoites

Other mutants
RMgm-675: An independent mutant lacking expression of HSP20 (and expressing GFP under the control of the cs promoter).
RMgm-676: A mutant expressing a mCherry-tagged from of HSP20


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0714300
Gene Model P. falciparum ortholog PF3D7_0816500
Gene productsmall heat shock protein HSP20, putative
Gene product: Alternative nameHSP20
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SacII, KpnI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationFor disruption of PbHSP20 two fragments were amplified using primers 5’UTR Hsp20 SacII (5´-TCCCCGCGGGGAGTTTAAAATTATTGCTAGTTC-3´,SacII is underlined) and 5’UTR Hsp20 NotI (5´- ATAAGAATGCGGCCGCACGTATGTATATATATATG -3´; NotI site is underlined) for the 529 base pair 5´ fragment and 3’UTR Hsp20 HindIII, (5´-
CCCAAGCTTGGGGTATATGCTTGTTCATATAGTC-3’; HindIII site is underlined) and 3’UTR Hsp20 KpnI (5’-GGGGTACCCCTATAATATTTGTGTTCTTTTTGCG-3´); KpnI site is underlined) for the 726 base pair 3´ fragment using P. berghei genomic DNA as template. Both fragments were cloned into the P. berghei transfection vector b3D+ resulting in the pHsp20repBD3+ plasmid. Parasites were transfected with SacII/KpnI- digested Hsp20repBD3+ plasmid, using the Nucleofector device (Amaxa GmbH), and injected into naïve mice.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TCCCCGCGGGGAGTTTAAAATTATTGCTAGTTC
Additional information primer 15’UTR Hsp20 SacII
Sequence Primer 2ATAAGAATGCGGCCGCACGTATGTATATATATATG
Additional information primer 25’UTR Hsp20 NotI
Sequence Primer 3CCCAAGCTTGGGGTATATGCTTGTTCATATAGTC
Additional information primer 33’UTR Hsp20 HindIII
Sequence Primer 4GGGGTACCCCTATAATATTTGTGTTCTTTTTGCG
Additional information primer 43’UTR Hsp20 KpnI
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP (gfp-mu3)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
" 1 aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt
51 tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta
101 atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg
151 aatggcgaat ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg
201 tatttcacac cgcatatggt gcactctcag tacaatctgc tctgatgccg
251 catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga
301 cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc
351 cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga
401 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata
451 ataatggttt cttagacgtc aggtggcact tttcggggaa atgtgcgcgg
501 aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca
551 tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt
601 atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt
651 ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg
701 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac
751 agcggtaaga tccttgagag ttttcgcccc gaagaacgtt ttccaatgat
801 gagcactttt aaagttctgc tatgtggcgc ggtattatcc cgtattgacg
851 ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg
901 gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt
951 aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca
1001 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg
1051 cacaacatgg gggatcatgt aactcgcctt gatcgttggg aaccggagct
1101 gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa
1151 tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct
1201 tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc
1251 acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg
1301 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat
1351 ggtaagccct cccgtatcgt agttatctac acgacgggga gtcaggcaac
1401 tatggatgaa cgaaatagac agatcgctga gataggtgcc tcactgatta
1451 agcattggta actgtcagac caagtttact catatatact ttagattgat
1501 ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga
1551 taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt
1601 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg
1651 cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt
1701 ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct
1751 tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta
1801 ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct
1851 aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg
1901 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga
1951 acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga
2001 actgagatac ctacagcgtg agcattgaga aagcgccacg cttcccgaag
2051 ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag
2101 cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt
2151 cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag
2201 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc
2251 ctggcctttt gctggccttt tgctcacatg ttctttcctg cgttatcccc
2301 tgattctgtg gataaccgta ttaccgcctt tgagtgagct gataccgctc
2351 gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa
2401 gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta
2451 atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca
2501 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac
2551 tttatgcttc cggctcgtat gttgtgtgga attgtgagcg gataacaatt
2601 tcacacagga aacagctatg accatgatta cgccaagctt ccgcgggtat
2651 atggtaaaga acctactaac acaataaaat atttaaataa tgtatttcct
2701 ataaataaat ttacagattt attttttaat acaaaagata tagatatacc
2751 agaaataaat gatcagttta aaggttttaa attctttatg acatcattta
2801 taaatcatgg atcatatcca ctaacaatag aatgtggtgt aacaaatggt
2851 ggaactagtt ataaaagagc aattatttta ttgcatgttc gaactgattt
2901 aaaagataga ccagtttcat tttgtgattt tcgaaaagga gaattatata
2951 attatttgaa tgcttatact gaaggggatg tatgcataat aatttccaaa
3001 tcaaatacaa gttttggttt tagatgccca gtaaatacaa aaaaaatgcc
3051 aaaaaattgt tttacgcaag tatatgaaaa agggtatcta aatgacgcca
3101 ataaaattaa tactaaaaat gttattaact attcatttga aaatccagaa
3151 tatgcgctag ctggttytaa ttatacatta acaaaatcgt atcaatttga
3201 atgtcattgt gtagataaag aaacagaaca aattgtaaaa acggttttag
3251 tcaaatatgt aaatgaagat gaaatatatg attataatga ttttccaatg
3301 gtgaatcaca aacctattat tgcacatcca aataaaacac atcaagcttg
3351 catgcctgca gcccagctta attcttttcg agctctttat gcttaagttt
3401 acaatttaat attcatactt taagtatttt ttgtagtatc ctagatattg
3451 tgctttaaat gctcacccct caaagcacca gtaatatttt catccactga
3501 aataccatta aattttcaaa aaaatactat gcatataatg ttatacatat
3551 aaacataaaa cgccatgtaa atcaaaaaat atataaaaat atgtataaaa
3601 ataaatatgc actaaatata agctaattat gcataaaaat taaagtgccc
3651 tttattaact agtcgtaatt atttatattt ctatgttata aaaaaatcct
3701 catataataa tataattaat atatgtaatg ttttttttat tttataattt
3751 taatataaaa taatatgtaa attaattcaa aaaataaata taattgttgt
3801 gaaacaaaaa acgtaatttt ttcatttgcc ttcaaaattt aaatttattt
3851 taatatttcc taaaatatat atactttgtg tataaatata taaaaatata
3901 tatttgctta taaataaata aaaaatttta taaaacatag ggggatccat
3951 gagtaaagga gaagaacttt tcactggagt tgtcccaatt cttgttgaat
4001 tagatggtga tgttaatggg cacaaatttt ctgtcagtgg agagggtgaa
4051 ggtgatgcaa catacggaaa acttaccctt aaatttattt gcactactgg
4101 aaaactacct gttccatggc caacacttgt cactactttc ggttatggtg
4151 ttcaatgctt tgcgagatac ccagatcata tgaaacagca tgactttttc
4201 aagagtgcca tgcccgaagg ttatgtacag gaaagaacta tatttttcaa
4251 agatgacggg aactacaaga cacgtgctga agtcaagttt gaaggtgata
4301 cccttgttaa tagaatcgag ttaaaaggta ttgattttaa agaagatgga
4351 aacattcttg gacacaaatt ggaatacaac tataactcac acaatgtata
4401 catcatggca gacaaacaaa agaatggaat caaagttaac ttcaaaatta
4451 gacacaacat tgaagatgga agcgttcaac tagcagacca ttatcaacaa
4501 aatactccaa ttggcgatgg ccctgtcctt ttaccagaca accattacct
4551 gtccacacaa tctgcccttt cgaaagatcc caacgaaaag agagaccaca
4601 tggtccttct tgagtttgta acagctgctg ggattacaca tggcatggat
4651 gaactataca aataaatgga tcccgttttt cttacttata tatttatacc
4701 aattgattgt atttataact gtaaaaatgt gtatgttgtg tgcatatttt
4751 tttttgtgca tgcacatgca tgtaaatagc taaaattatg aacattttat
4801 tttttgttca gaaaaaaaaa actttacaca cataaaatgg ctagtatgaa
4851 tagccatatt ttatataaat taaatcctat gaatttatga ccatattaaa
4901 aatttagata tttatggaac ataatatgtt tgaaacaata agacaaaatt
4951 attattatta ttattatttt tactgttata attatgttgt ctcttcaatg
5001 attcataaat agttggactt gatttttaaa atgtttataa tatgattagc
5051 atagttaaat aaaaaaagtt gaaaaattaa aaaaaaacat ataaacacaa
5101 atgatgtttt ttccttcaat ttcgggtacc gagctcgaat tctcttgagc
5151 ccgttaatga aatagataca attcattcat gttatataca tctagaacat
5201 aatctgaata tggttcaagt taaatgtcca aaaattataa aaagtgatga
5251 tatttttgat ggtaatacca taatagacac caaggtaaca tcacgaagta
5301 gtcaacaaaa taatttttat ttagaaaata cagatgttga accagaagaa
5351 atagagaaat ataaaaatat agaatacata ccagaaaacg atgaagtaat
5401 gcatctagac aaaaaagaaa agctagatga tatattacca ggtgttatca
5451 tattagataa aaataaaatg ttcaaagaaa aaggacattt cacttttgtt
5501 actccattaa ttgtagaaaa ggtattaata ttaaaaatat attgtgataa
5551 tactaaaaca ataattaata atatgaaagg gaaaaaaggt attacagtaa
5601 taaggatttc tcaaaataca acaaaaaata aattttatgg atgtgacttt
5651 tcaggtaatt ctaaaaaaac attttactat tccaatgttt atgatttaga
5701 aaaaaaaaat gagttttgtg aaatagaatt aaaagaaaat atagtagtta
5751 gcttaaattg tccaactggt aaaattaatc caaaaaattg ttttagaaat
5801 gtatatataa aaagtaatat gaatgaacaa acaaccgaaa atatagaaaa
5851 tatatttaac gaaataaaag ttatagatgc agattatttt ataaataatt
5901 catcaacctt tttgatgatt tccaaaatta caaaaaaaga gtttgatttt
5951 tattgtacat gtgaagatta taaaaccaaa aatataggaa caatatatat
6001 taaaaattat gaatatctag attcaaaacc taaatataaa aataaacaaa
6051 tttcctatat agatgtagtt ccatacccgc ggggaaaggg cg"
Restriction sites to linearize plasmid KspI (SacII)
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markereef1a
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP gene (1 copy) has been inserted into the 230p locus (PBANKA_030600) by double cross-over integration.
Additional remarks selection procedureThis reporter mutant expressing GFP does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence.
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 15'-cccaagcttccgcgggtatatggtaaagaacctactaacac
Additional information primer 1primer L1345: 0.7kb 5'region of PBANKA_030600 (230p gene)
Sequence Primer 25'-cccaagcttgatgtgttttatttggatgtgc
Additional information primer 2primer L1346: 0.7kb 5'region of PBANKA_030600 (230p gene)
Sequence Primer 35'-ccggaattctcttgagcccgttaatg
Additional information primer 3primer L1347: 1kb 3'region of PBANKA_030600 (230p gene)
Sequence Primer 45'-tccccgcgggtatggaactacatctatatagg
Additional information primer 4primer L1348: 1kb 3'region of PBANKA_030600 (230p gene)