SummaryRMgm-663
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene tagging |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 22184632 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA cl15cy1 |
Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | J. Fonager; B. Franke-Fayard; C.J. Janse |
Name Group/Department | Leiden Malaria Research Group |
Name Institute | Leiden University Medical Center |
City | Leiden |
Country | The Netherlands |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-663 |
Principal name | 1262cl2 |
Alternative name | smac::mCherry |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | smac::mCherry signals detected in all blood stages, both in the cytoplasm of the parasite and in the cytoplasm of the infected erythrocyte (see 'Additional remarks phenotype'). |
Gametocyte/Gamete | Not tested |
Fertilization and ookinete | Not tested |
Oocyst | Not tested |
Sporozoite | Not tested |
Liver stage | Not tested |
Additional remarks phenotype | Mutant/mutation Protein (function) Phenotype analyses of mutants lacking expression of SMAC (RMgm-661, RMgm-662) indicate that asexual blood stages show a reduced growth rate in mice (see 'Additional information'). Additional information Other mutants |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0100600 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | Not available | ||||||||||||||||||||||||||
Gene product | schizont membrane associated cytoadherence protein | ||||||||||||||||||||||||||
Gene product: Alternative name | Schizont Membrane Associated Cytoadherence protein; SMAC | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Name of the tag | mCherry | ||||||||||||||||||||||||||
Details of tagging | C-terminal | ||||||||||||||||||||||||||
Additional remarks: tagging | |||||||||||||||||||||||||||
Commercial source of tag-antibodies | Santa Cruz Biotechnology | ||||||||||||||||||||||||||
Type of plasmid/construct | Plasmid single cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence |
CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTC
| ||||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | To generate transgenic parasites expressing SMAC that is C-terminally tagged with mCherry construct pL1419 was generated. First the mCherry gene of pL0017-mCherry (Graewe et al., 2009) was cloned into pL0017eGFPcam (BamHI/XbaI). Next, the mCherry expression cassette of pL0017mCherrycam was subcloned in pBluescript (BamHI/EcoRI) and then cloned (HindIII/EcoRI) into pL0001 to obtain the mCherry-tagging vector. Finally, the smac targeting region (primers 3774-3775; SpeI/BglII) was cloned into the mCherry-tagging plasmid cut with SpeI/BamHI to obtain pL1419. | ||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |