RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-633
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1030100; Gene model (P.falciparum): PF3D7_1412500; Gene product: actin II (actin2)
Name tag: GFP
Phenotype Gametocyte/Gamete;
Last modified: 1 July 2012, 14:55
  *RMgm-633
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21790945
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherE. Deligianni; I. Siden-Kiamos
Name Group/DepartmentInstitute of Molecular Biology and Biotechnology
Name InstituteFORTH
CityHeraklion
CountryGreece
Name of the mutant parasite
RMgm numberRMgm-633
Principal nameGFP-actin II
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteEvidence is presented that GFP-tagged Actin II is expressed exclusively in male gametocytes/gametes.
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a GFP-tagged form of Actin II. The tagged-gene is introduced as an episome. The actin II gene is under the control of the 5'UTR and 3'UTR regions of actin II and dhfr-ts, respectively.

Protein (function)
Actin, a cytoskeletal protein, has many diverse functions in eukaryotic cells ranging from roles in cell motility, cell division, vesicle trafficking to functions in cell signaling and regulation of transcription. A critical property of actin is its ability to form filamentous polymers (F-actin), and a plethora of proteins are involved in the highly dynamic regulation of F-actin formation . Actins are highly conserved proteins that often exist in multiple isoforms in the eukaryotic cell and their expression is regulated both spatially and temporally during development. The number of conventional actin genes varies among eukaryotic organisms. A few single cell eukaryotes, such as Saccharomyces cerevisiae, Toxoplasma gondii, and Trypanosoma brucei encode a single actin gene, which results in lethality when targeted with gene ablation approaches. Many organisms, however, have several conventional actin genes.Apicomplexan parasites all encode one major actin isoform, here termed Actin I. All apicomplexan parasites also contain a number of actin-related and actin-like proteins. Plasmodium species species stand out in that they all encode a second conventional actin, termed Actin II.
Phenotype analyses of mutants lacking expression of Actin II indicate a major role of Actin II in the formation of male gametes (see mutant RMgm-632).

Phenotype
Phenotype analyses of mutants lacking expression of Actin II indicate a major role of Actin II in the formation of male gametes (see mutant RMgm-632).
Evidence is presented that GFP-tagged Actin II is expressed exclusively in male gametocytes/gametes.

Additional information
Analyses of the blood stages of the mutant indicate  exclusive expression the the male gametocytes/male gametes.  Evidence is presented that the protein is located exclusively in the cytoplasm with no apparent accumulation to subcellular structures. Eight min after male activation the protein was observed in a narrow rim of cytoplasm surrounding the nucleus. In contrast Actin I was detected in both the cytoplasm and nuclei of non-activated gametocytes as shown by staining with an anti Actin I antibody. No specific localization of GFP-Actin II to the axonemes could be detected in double stainings of activated gametocytes/male gametes with an anti-tubulin antibody.
Evidence is presented that in activated males of wild type gametocytes Actin I relocalizes from the nucleus to the cytoplasm. This relocalisation was not observed in male gametes of the mutant lacking expression of Actin II.

Other mutants
RMgm-632: A mutant lacking expression of Actin II
RMgm-634: A mutant  expressing GFP under control of the promoter region of actin II.


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1030100
Gene Model P. falciparum ortholog PF3D7_1412500
Gene productactin II
Gene product: Alternative nameactin2
Details of the genetic modification
Name of the tagGFP
Details of taggingN-terminal
Additional remarks: taggingActin II gene is expressed as a C-terminal fusion to GFP interspersed by a linker under the control of 1.2 kb of the actin II 5’-UTR. The linker encodes the amino acids Ala4ValAspAla4. The 3’UTR originated from the P. berghei dhfr-ts gene. Tagged actin II was introduced and maintained as an episome
Commercial source of tag-antibodiesInvitrogen
Type of plasmid/constructCircular plasmid
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GCCCCGGGCATGGTACCTCTTTCTTCATATACATACCTTTC
Additional information primer 15’FRSH; Actin II 5'UTR
Sequence Primer 2ACGGATCCCATGCTAGCCTAAAAATAAACAATTGTGAACACAG
Additional information primer 25’FRA2U5R; Actin II 5'UTR
Sequence Primer 3GCCTCGAGCATGCTAGCATGGTGAGCAAGGGCGAGGAGCTG
Additional information primer 3CFPA2P1; GFP
Sequence Primer 4ACGCGTCGACTGCTGCTGCTGCCTTGTACAGCTCGTCCATGCC
Additional information primer 4CFPA2P2; GFP
Sequence Primer 5ACGCGTCGACGCAGCAGCAGCACCAGAAGAATCAATAGCTTTAGTG
Additional information primer 5CFPA2P3; Actin II ORF
Sequence Primer 6ACGAATTCTTAGAAGCACTTTCTGTGAACG
Additional information primer 6RevActII; Actin II ORF