Summary

RMgm-632
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1030100; Gene model (P.falciparum): PF3D7_1412500; Gene product: actin II (actin2)
Phenotype Gametocyte/Gamete; Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 1 July 2012, 14:54
  *RMgm-632
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21790945
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherE. Deligianni; I. Siden-Kiamos
Name Group/DepartmentInstitute of Molecular Biology and Biotechnology
Name InstituteFORTH
CityHeraklion
CountryGreece
Name of the mutant parasite
RMgm numberRMgm-632
Principal nameactII (-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteProduction of normal numbers of male and female gametocytes. Male gametocytes show a strong reduction in gamete formation (exflagellation)
Fertilization and ookineteProduction of normal numbers of male and female gametocytes. Male gametocytes show a strong reduction in gamete formation (exflagellation) and ookinete formation was reduced ~50 fold compared to wild type.
OocystMale gametocytes show a strong reduction in gamete formation (exflagellation) and ookinete formation is reduced ~50 fold compared to wild type. No oocysts are formed in Anopheles gambiae mosquitoes.
SporozoiteOokinete formation is reduced ~50 fold compared to wild type and no oocysts are formed in Anopheles gambiae mosquitoes.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of Actin II

Protein (function)
Actin, a cytoskeletal protein, has many diverse functions in eukaryotic cells ranging from roles in cell motility, cell division, vesicle trafficking to functions in cell signaling and regulation of transcription. A critical property of actin is its ability to form filamentous polymers (F-actin), and a plethora of proteins are involved in the highly dynamic regulation of F-actin formation . Actins are highly conserved proteins that often exist in multiple isoforms in the eukaryotic cell and their expression is regulated both spatially and temporally during development. The number of conventional actin genes varies among eukaryotic organisms. A few single cell eukaryotes, such as Saccharomyces cerevisiae, Toxoplasma gondii, and Trypanosoma brucei encode a single actin gene, which results in lethality when targeted with gene ablation approaches. Many organisms, however, have several conventional actin genes.Apicomplexan parasites all encode one major actin isoform, here termed Actin I. All apicomplexan parasites also contain a number of actin-related and actin-like proteins. Plasmodium species species stand out in that they all encode a second conventional actin, termed Actin II.

Phenotype
Phenotype analyses indicate that Actin II plays a major role during the formation of the male gametes (see also 'Additional information'). Female gametes are fertile as shown in cross-fertilisation studies with fertile male gametes.

Additional information
Evidence is presented that in activated male gametocytes of the mutant axonemes are formed but formation of active, beating flagella fails and male gametes appear to be defective in egress from the host erythrocyte.

Analyses of blood stages of a mutant expressing GFP under the control of the 1.2kb promoter region of actin II (RMgm-634) indicate 'upregulated expression the the male gametocytes' and low or absent actin II expression in asexual blood stages and female gametocytes.

Analyses of blood stages of a mutant expressing a GFP-tagged form of Actin II (RMgm-633) indicate  exclusive expression the the male gametocytes (male gamete).  Evidence is presented that the protein is located exclusively in the cytoplasm with no apparent accumulation to subcellular structures. Eight min after male activation the protein was observed in a narrow rim of cytoplasm surrounding the nucleus. In contrast Actin I was detected in both the cytoplasm and nuclei of non-activated gametocytes as shown by staining with an anti Actin I antibody. No specific localization of GFP-Actin II to the axonemes could be detected in double stainings of activated gametocytes/male gametes with an anti-tubulin antibody.
Evidence is presented that in activated males of wild type gametocytes Actin I relocalizes from the nucleus to the cytoplasm. This relocalisation was not observed in male gametes of the mutant lacking expression of Actin II.

The function of the mutant was restored by complementing the actII(-) line with the wild type actin II gene under control of it own promoter and regulated by the 3’UTR of the P. berghei dhfr-ts gene. The complementary actin II gene was inserted into the small subunit ribosomal rna gene (c-type unit) by single cross-over integration. In this complemented parasite line actIIC, actin II transcripts were readily detectable by RT-PCR. The complemented parasites were tested for exflagellation and ookinete conversion, which revealed partial complementation.

Other mutants
RMgm-633: A mutant expressing a GFP-tagged form of Actin II
RMgm-634: A mutant  expressing GFP under control of the promoter region of actin II


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1030100
Gene Model P. falciparum ortholog PF3D7_1412500
Gene productactin II
Gene product: Alternative nameactin2
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, BamHI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption Of the 1263bp actin II open reading frame, nucleotides 404 - 727 were disrupted by the genetic modification.
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCACCCAATTTTATATCATTCAATAC
Additional information primer 1Knockout construct 5’ fragment F (KpnI)
Sequence Primer 2CCCAAGCTTCTAACATACATAGCTGGAAC
Additional information primer 2Knockout construct 5’ fragment R (HindIII)
Sequence Primer 3GGAATTCCTTTTACTACAACCGCTG
Additional information primer 3Knockout construct 3’ fragment F (EcoRI)
Sequence Primer 4CGGGATCCTCGTATTCTTCTTTTGTTATCC
Additional information primer 4Knockout construct 3’ fragment R (BamHI)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6