SummaryRMgm-628
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene tagging |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 32979009 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA cl15cy1 |
Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | C.J. Janse; O. Klop; B.M. Franke-Fayard |
Name Group/Department | Leiden Malaria Research Group |
Name Institute | Leiden University Medical Center |
City | Leiden |
Country | The Netherlands |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-628 |
Principal name | 1964 |
Alternative name | RON4::mCherry |
Standardized name | |
Is the mutant parasite cloned after genetic modification | No |
top of page | |
Phenotype | |
Asexual blood stage | Schizonts express mCherry-tagged RON4 as shown by fluorescence microscopy. Merozoites of mature schizonts show a 'rhoptry-like' fluorescence pattern (see also 'Additional remarks phenotype'). |
Gametocyte/Gamete | Not tested |
Fertilization and ookinete | Not tested |
Oocyst | Not tested |
Sporozoite | RON4::mCherry expression in sporozoites |
Liver stage | Not tested |
Additional remarks phenotype | Mutant/mutation The mutant has been (described and) used to analyse sporozoite migration in hepatocytes (Published in PMID: 32979009) Additional information
Other mutants |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0932000 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1116000 | ||||||||||||||||||||||||||
Gene product | rhoptry neck protein 4 | ||||||||||||||||||||||||||
Gene product: Alternative name | RON4 | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Name of the tag | mCherry | ||||||||||||||||||||||||||
Details of tagging | C-terminal | ||||||||||||||||||||||||||
Additional remarks: tagging | |||||||||||||||||||||||||||
Commercial source of tag-antibodies | |||||||||||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence |
CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTC
| ||||||||||||||||||||||||||
Restriction sites to linearize plasmid | NdeI | ||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | To generate the transgenic RON4-mCherry, parasites expressing C-terminally tagged mCherry RON4 (PBANKA_932000), construct pL1577 was used (Fougere et al., 2016). The smac (PBANKA_0100600) was exchanged for the ron4 targeting region amplified with primers 6686 and 6687 (5’- gggactagtGCATCCATATTAATGCAACAATGG and 5’- cccggatccTAAATCATCAAAAATGGCTTTCTC) using restriction sites, SpeI/BamHI. Tranfection (exp. 1964; RMgm-628; www.pberghei.eu) of the linearized pL1837 plasmid (using NdeI), selection and cloning of transformed parasites was performed using standard genetic modification technologies | ||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |