RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-213
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1315700; Gene model (P.falciparum): PF3D7_1452000; Gene product: rhoptry neck protein 2 (RON2)
Name tag: c-myc
Phenotype Asexual bloodstage; Oocyst; Sporozoite;
Last modified: 15 March 2013, 17:45
  *RMgm-213
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19428669
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherM. Tufet-Bayona, C.J. Janse, R.E. Sinden, B. Franke-Fayard
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center (LUMC)
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-213
Principal nameRON2-Myc
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageThe blood-stage ‘ring-forms’, trophozoites and young schizonts, show no detectable expression of RON2-Myc using monoclonal anti-MYC antibodies. RON2-Myc expression is observed in schizonts and merozoites. Merozoites show a 'two-dot' staining pattern which is characteristic for location in the two rhoptry-organelles.
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystRON2-Myc is not detected in gametocytes and ookinetes. It is expressed in both oocyst-derived sporozoites, obtained at days 9–13 after infection, and also in salivary gland sporozoites. Staining is observed at the apical end of the sporozoite, extending from the mid portion anterior to the nucleus to the apical tip of the sporozoite.
SporozoiteRON2-Myc is expressed in both oocyst-derived sporozoites, obtained at days 9–13 after infection, and also in salivary gland sporozoites. Staining is observed at the apical end of the sporozoite, extending from the mid portion anterior to the nucleus to the apical tip of the sporozoite.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a c-terminal cMyc-tagged RON2 (rhoptry neck protein 2).

Protein (function)
RON2 shows sequence homology with a proven rhoptry protein of Toxoplasma gondii (145.m00331; twinscan-0698; RON2). See also 'Additional Information'.

Phenotype
The phenotype analyses indicate expression of cMyc-tagged RON2 in rhoptries of merozoites and rhoptries of the sporozoites (see also Additional information'). No expression was observed in ookinetes which is in agreement with the proposed lack of rhoptries in this third invasive form of Plasmodium.

Additional information
In T. gondii RON2 is localized specifically to the duct-like neck portion of the rhoptries, leading to the designation as rhoptry neck (RON) protein. Upon invasion of the host cell, T. gondii RON2 is associated with both the micronemal apical-membrane antigen 1 (AMA1) and RON4, and they localize to the moving junction that is formed upon  invasion. The Plasmodium homologue of RON4 has  been shown to interact with AMA1 of P. falciparum.

Staining of sporozoites with cMyc-antibodies showed staining at the apical end of the sporozoite, extending from the mid portion anterior to the nucleus to the apical tip of the sporozoite. The staining pattern is comparable to the fluorescence pattern of the GFP-tagged rhoptry protein RAP2/3 in sporozoites (see RMgm-209) which suggests a rhoptry localisation for RON2.

Other mutants
RMgm-214: Unsuccessful attempts to disrupt the ron2 gene


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1315700
Gene Model P. falciparum ortholog PF3D7_1452000
Gene productrhoptry neck protein 2
Gene product: Alternative nameRON2
Details of the genetic modification
Name of the tagc-myc
Details of taggingC-terminal
Additional remarks: taggingThe chosen integration strategy for the construct results in integration at the target locus by a single cross-over homologous recombination event. This construct contains the C-terminal region of RON2, followed by two myc epitopes. Integration of this construct results in the presence of a complete copy of ron2 tagged with myc and two incomplete copies of ron2, also containing myc tags.
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid PacI
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CGGGGTACCGCGACCGTCTACATCGGCCTTTATTCCCC
Additional information primer 1MT21 (KpnI); ron2 coding sequence
Sequence Primer 2TTGGGCCCTACTACGATTTTAGCATAAGATACATAATG
Additional information primer 2MT37 (ApaI); ron2 coding sequence
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6