RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-57

Malaria parasite	P. berghei
Genotype
Mutated	Gene model (rodent): PBANKA_1349800; Gene model (P.falciparum): PF3D7_1335900; Gene product: thrombospondin-related anonymous protein \| sporozoite surface protein 2 (sporozoite surface protein 2; SSP2; SSP-2; TRAP) Details mutation: The cytoplasmic tail domain (CTD) of TRAP replaced with the CTD of T. gondii MIC2
Phenotype	No phenotype has been described

Last modified: 4 March 2010, 23:39

*RMgm-57

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene mutation
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 10579715
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei NK65
Name parent line/clone	Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/Researcher	S. Kappe, V. Nussenzweig, R. Menard
Name Group/Department	Department of Pathology, Kaplan Cancer Center
Name Institute	New York University School of Medicine
City	New York
Country	USA
top of page
Name of the mutant parasite
RMgm number	RMgm-57
Principal name	TMIC
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not different from wild type
Gametocyte/Gamete	Not different from wild type
Fertilization and ookinete	Not different from wild type
Oocyst	Not different from wild type
Sporozoite	Not different from wild type
Liver stage	Not different from wild type
Additional remarks phenotype	Mutant/mutation The mutant expresses a mutated form of TRAP (thrombospondin-related anonymous protein) in which 37 carboxy-terminal residues of the cytoplasmic tail are replaced with the cytoplasmic tail of MIC2 which is a TRAP-related protein expressed by tachyzoites of Toxoplasma gondii. Protein (function) TRAP is a type 1 transmembrane protein, containing two adhesive domains in its extracellular portion, an A-domain of von Willebrand factor and a thrombospondin type I repeat (TSR, TSP). The cytoplasmic part (tail) of the protein is postulated to interact with actin–myosin motor proteins giving the force needed for motility. TRAP is located in the micronemes of sporozoites. The protein plays a role in the gliding motility of sporozoites and invasion of host cells as has been shown by analysis of mutant parasites lacking expression of TRAP (RMgm-47; RMgm-53). Phenotype Analysis of the phenotype of mutants with a mutated cytoplasmic tail (RMgm-54; RMgm-55; RMgm-56) showed that the cytoplasmic tail is essential for sporozoite motility and invasion of host cells (infectivity). The lack of an effect on sporozoite motility and infectivity of the replacement of the Plasmodium cytoplasmic tail of TRAP with the cytoplasmic tail MIC2 of T. gondii shows that the function of the cytoplasmic tails is conserved between different species (despite little primary amino acid sequence similarity). The role of the different domains of the protein in motility and invasion has been analysed in other mutant parasites expressing mutated forms of TRAP (see below). Other mutants P. berghei mutants have been generated with mutated cytoplasmic tails of TRAP (RMgm-54; RMgm-55; RMgm-56; RMgm-149, RMgm-150, RMgm-151). Other P. berghei mutants have been generated with mutated extracellular (adhesive) domains (A-domain: RMgm-48; RMgm-49; TSR domain: RMgm-50; RMgm-51; A-domain and TSR domain: RMgm-52). A P. berghei mutant has been generated in which the endogenous P. berghei trap was replaced with (mutated forms of) P. falciparum trap (RMgm-58)

Mutated: Mutant parasite with a mutated gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_1349800

Gene Model P. falciparum ortholog

PF3D7_1335900

Gene product

thrombospondin-related anonymous protein | sporozoite surface protein 2

Gene product: Alternative name

sporozoite surface protein 2; SSP2; SSP-2; TRAP

top of page

Details of the genetic modification

Short description of the mutation

The cytoplasmic tail domain (CTD) of TRAP replaced with the CTD of T. gondii MIC2

Inducable system used

Short description of the conditional mutagenesis

Not available

Additional remarks inducable system

Type of plasmid/construct

Plasmid single cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

Selectable marker used to select the mutant parasite

pbdhfr

Promoter of the selectable marker

pbdhfr

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

The construct used results in 'disruption of the wild type trap-gene and introduction of a full length mutated trap gene under control of the wild type regulatory (3'UTR, 5'UTR) sequences.
The mutant expresses a mutated form of TRAP (thrombospondin-related anonymous protein) in which 37 carboxy-terminal residues of the cytoplasmic tail are replaced with the cytoplasmic tail of MIC2 which is a TRAP-related protein expressed by tachyzoites of Toxoplasma gondii. The DNA encoding the cytoplasmic tail of MIC2 was amplified from the XhoI fragment of BAC G11-11 (Wan et al., 1997) using 5'primer P27 (5'AAAACTGCAGGATCCCCATCCGCGGAGATAG 3') and 3'primer P28 (5'TGCTCTAGATATATATGTTTATTAAAATTACTCCATCCACATATCACTATCG 3')

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page