top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PBANKA_0831000
|
Gene Model P. falciparum ortholog |
PF3D7_0930300
|
Gene product | merozoite surface protein 1 |
Gene product: Alternative name | MSP-1, MSP1 |
top of page |
Details of the genetic modification |
Short description of the mutation | Replacement of the P. berghei MSP-1 19 kD C-terminal with the P. falciparum MSP-1 19 kD C-terminal. |
Inducable system used | No |
Short description of the conditional mutagenesis | Not available |
Additional remarks inducable system |
|
Type of plasmid/construct | Plasmid double cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
KpnI, SacI
|
Selectable marker used to select the mutant parasite | pbdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | To create the PbfMSP1 fusion gene, the 1,423-base pair (bp) P. berghei MSP1 targeting sequence and the 330-bp PfMSP1-19 fragment were PCR amplified from P. berghei ANKA genomic DNA and a P. falciparum FCC1/HN isolate, respectively, using primers PbF and PbR, and PfF and PfR. The two PCR products were fused in frame by using the primers PbF and PfR and resulted in PbfMSP1. The 860-bp PfHSP86 3′ untranslated region (UTR) was amplified from plasmid pHC1 (a gift from the Malaria Research and Reference Reagent Resource Center) using the primers HSPF (5′-CGGCTCGAGTTATATAATATATTTATGTAC-3′) and HSPR (5′-CGGGGATCCTATTTGATGAATTAACTACAC-3′) and ligated in the correct orientation to PbfMSP1 to create a 2.6 kb fragment that was cloned into the SacI/BamHI sites of pPyrFlu. The other 0.5 kb targeting sequence of PbMSP-1 3′UTR was also amplified from P. berghei ANKA genomic DNA using the primers Pb3′F and Pb3′R and then cloned into the ApaI/KpnI sites of pPyrFlu. The resulting vector containing PyrFlu/PbfMSP-1/ PbM3′ was linearized with KpnI and SacI before transfection. |
Additional remarks selection procedure | Parasites were selected using pyrimethamine. When green fluorescence parasites were observed in pyrimethamine-resistant parasite populations, cloning was performed by limiting dilution. |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | CGCGAGCTCTTAACAAAAGAAGAGAAGC |
Additional information primer 1 | PbF (SacI); 1.4 kb PbMSP1 targeting sequence |
Sequence Primer 2 | GCATACATGCTTAGGGTCTATACCtaataaatc |
Additional information primer 2 | PbR; 1.4 kb PbMSP1 targeting sequence (PCR fusion homology with PfF in caps) |
Sequence Primer 3 | GGTATAGACCCTAAGCATGTATGCaaaaaaacaatgtccag |
Additional information primer 3 | PfF; 0.33 kb msp1-19 region of P. falciparum (PCR fusion homology with PbR in caps) |
Sequence Primer 4 | CGCGTCGACTTAAATGAAACTGTATAATATTAAC |
Additional information primer 4 | PfR (SalI); 0.33 kb msp1-19 region of P. falciparum |
Sequence Primer 5 | GGCGGGCCCATAAATTATTGAAATATTTGTTG |
Additional information primer 5 | Pb3'F (ApaI); 0.5 kb PbMSP-1 3′UTR targeting sequence |
Sequence Primer 6 | CGCGGTACCTATACAAAACATATACA |
Additional information primer 6 | Pb3'R (KpnI); 0.5 kb PbMSP-1 3′UTR targeting sequence |
|
|
top of page |