Summary

RMgm-201
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_0831000; Gene model (P.falciparum): PF3D7_0930300; Gene product: merozoite surface protein 1 (MSP-1, MSP1)
Details mutation: Replacement of the P. berghei MSP-1 19 kD C-terminal with the P. falciparum MSP-1 19 kD C-terminal
Phenotype Asexual bloodstage;
Last modified: 26 September 2009, 21:50
  *RMgm-201
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 12963693
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherT.F. de Koning-Ward; B.S. Crabb
Name Group/DepartmentNot applicable
Name InstituteThe Walter and Eliza Hall Institute of Medical Research
CityParkville, Victoria 3050
CountryAustralia
Name of the mutant parasite
RMgm numberRMgm-201
Principal namePb-PfM19
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageGrowth of asexual blood stages of the mutant parasites and the course of parasitemia in mice were comparable to wild type parasites. See further 'Phenotype' and 'additional information'.
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant, Pb-PfM19, expresses a mutated form of merozoite surface protein 1, precursor (MSP1). The P. berghei MSP-1 19 kD C-terminal region is replaced with the P. falciparum MSP-1 19 kD C-terminal region. The transfection vector was designed to integrate into P. berghei MSP-1 and replace the endogenous sequences encoding epidermal growth factor (EGF) domains 1 and 2, and the GPI recognition sequence, with the corresponding P. falciparum (D10 line) sequence.
A second chimeric line, Pb-PbM19, with a homologous P. berghei MSP-119 replacement, was also constructed to generate a control transfectant.

Protein (function)
MSP1 is an attractive target for antibody therapy. Animals actively or passively immunized against MSP1 can be protected against parasite challenge, and mAbs to MSP1 can block parasite invasion of erythrocytes in vitro. MSP1 undergoes dual proteolytic processing. It is initially cleaved (primary processing) into multiple fragments that form a protein complex on the merozoite surface. Then, at erythrocyte invasion, the protein is cleaved again (secondary processing) and shed from the surface, except for a C-terminal 19-kDa polypeptide (MSP119) that comprises two epidermal growth factor (EGF)-like domains and which is carried into the newly invaded erythrocyte.

Phenotype
To determine whether the mutants Pb-PfM19 and Pb-PbM19 lines expressed the expected MSP-119 domains, Western blot analysis was performed on late stage parasite extracts using specific anti–MSP-119 antibodies. P. falciparum MSP-119 antibodies recognized both MSP-119 and an 200-kD band corresponding to full-length MSP-1 in Pb-PfM19 parasites but not in Pb-PbM19 parasites. In contrast, antibodies specific for P. berghei MSP-119 only recognized MSP-119 and full-length MSP-1 in wild-type P. berghei and the control line, Pb-PbM19. This indicates that P. falciparum MSP-119 can be correctly expressed and processed in P. berghei and that the endogenous MSP-119 gene is no longer expressed in Pb-PfM19 parasites. The localization of MSP-119 in P. berghei lines was also assessed by double-labeling IFA. Characteristic merozoite surface labeling was observed in both chimera lines, with Pb-PfM19 parasites reacting only with the P. falciparum–specific monoclonal antibody 4H9/19, whereas P. berghei wild-type and Pb-PbM19 chimeric parasites reacted only with rabbit anti–P. berghei MSP-119 antibodies. This indicates that the appropriate MSP-119 domain is correctly localized in both Pb-PbM19 and Pb-PfM19 parasite lines.

Mice made semi-immune to mutant Pb-PfM19 line generate high levels of merozoite inhibitory antibodies that are specific for P. falciparum MSP-119. Protection from homologous blood stage challenge in these mice correlated with levels of P. falciparum MSP-119–specific inhibitory antibodies, but not with titres of total MSP-119–specific immunoglobulins. The results indicate that merozoite inhibitory antibodies generated in response to infection can play a significant role in suppressing parasitemia in vivo.

Additional information
The rodent malaria parasite line that expresses P. falciparum MSP-119 in place of its own domain can be used as a simple and robust model to analyse the protective role of inhibitory antibodies in vivo. In this study  it was shown that the level of MSP-119–specific invasion inhibitory antibodies generated in mice that had been repeatedly exposed to this chimeric parasite line correlates with the ability of these animals to control a subsequent blood stage infection. The availability of this novel rodent malaria model might be used as an alternative to nonhuman primates for assessing and monitoring P. falciparum MSP-119–based vaccines.

Other mutants
RMgm-330: Another mutant in which the P. berghei MSP-1 19 kD C-terminal region is replaced with the P. falciparum MSP-1 19 kD C-terminal region.


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0831000
Gene Model P. falciparum ortholog PF3D7_0930300
Gene productmerozoite surface protein 1
Gene product: Alternative nameMSP-1, MSP1
Details of the genetic modification
Short description of the mutationReplacement of the P. berghei MSP-1 19 kD C-terminal with the P. falciparum MSP-1 19 kD C-terminal
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTo create pPb-PfM19, 1.3 Kb P. berghei MSP-1 targeting sequence was fused in frame to the MSP-119 region of P. falciparum. PCR was performed on P. berghei ANKA and P. falciparum D10 genomic DNA (gDNA) using oligonucleotides PbF (5'-CGGGGTACCATCGATAAATACTTTACCTCTGAAGCTGTTCC) and PbR1 (5'- TACATGCTTAGGGTCTATACCTAATAAATC), and PbPfF (5'-GGTATAGACCCTAAGCATGTATGCGTAAAAAAACAATGTCCAGAA) and PfR (5'-TGCTCTAGATTAAATGAAACTGTATAATATTAAC), respectively, and sewing products together via PCR using the primers PbF and PfR. The resulting fragment was cloned into the KpnI/XbaI sites of pGem4Z (Promega) that harbored the hsp86 3' untranslated region (UTR). The MSP-1/hsp86 3' sequence was excised with KpnI/HindIII, the HindIII site filled in with Klenow reagent and the fragment cloned into the KpnI/HincII site of pDBDTmHDB. A 0.55 Kb 3' targeting sequence was then cloned into the EcoRV/BamHI site of this vector to create pPb-PfM19. The 3' targeting region comprising the P. berghei MSP-1 3' UTR was identified by library screen and PCR amplified from P. berghei ANKA gDNA using oligonucleotides PbM3'F (5'-GGCGATATCATAAATTATTGAAATATTTGTTGGA) and PbM3'R (5'-CGCGGATCCTATACAAAACATATACAAC). The plasmid pPb-PbM19 is analogous to that of pPb-PfM19 with the exception that the entire MSP-1 5' targeting sequence is that of P. berghei. This fragment was amplified from P. berghei ANKA gDNA using the oligonucleotides PbF and PbR2 (5'-TGCTCTAGATTAAAATATATTAAATACAATTAATGTG).
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6