RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-322
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1038200; Gene model (P.falciparum): PF3D7_1403800; Gene product: nuclear formin-like protein MISFIT, putative | male-inherited sporulation factor important for transmission (MISFIT, male-inherited sporulation factor important for transmission)
Name tag: c-myc
Phenotype Gametocyte/Gamete; Fertilization and ookinete;
Last modified: 19 August 2009, 16:29
  *RMgm-322
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19662167
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherE.S.C. Bushell; D. Vlachou
Name Group/DepartmentDepartment of Life Sciences
Name InstituteImperial College London
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-322
Principal namepbmisfit-myc
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteLocalisation of the myc-tagged MISFIT protein in nuclei of male gametocytes and activated male gametocytes (immunofluorescence assays).
A weak, slightly above background signal in female gametocytes, in conjunction with earlier proteomic data, suggests the possibility of low protein expression in females. MISFIT was not detected in asexual blood stage trophozoites or schizonts.
Fertilization and ookineteLocalisation of the myc-tagged MISFIT protein in nuclei of zygotes and ookinetes.
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expressing a c-myc tagged (C-terminal) version of MISFIT

Protein (function)
MISFIT is an 180 kDa protein bearing a Formin Homology 2 (FH2) domain, the defining feature of formins, and a nuclear localization signal (NLS). Phenotype analyses of a mutant lacking expression of MISFIT (RMgm-321) indicate that MISFIT plays a critical role during development of the ookinete into the oocyst. Ookinetes invade the mosquito midgut but are arrested in development during their subsequent transformation into oocysts (see also 'Additional Information').

Phenotype
Phenotype analyses indicate expression of MISFIT in nuclei of male gametocytes, zygotes and ookinetes. The nuclear location is consistent with its NLS prediction.
Phenotype analyses of a mutant lacking expression of MISFIT (RMgm-321) indicate that MISFIT plays a critical role during development of the ookinete into the oocyst. Mosquitoes infected with parasites expressing myc-tagged MISFIT produced normal numbers of sporulating oocysts comparable to those in control mosquito infections, indicating that the tagged protein is fully functional.

Additional information
Contrary to the clear detection of myc-tagged in male gametes by western blot , immunofluorescence staining could not confirm the presence of this protein in emerging or released male gametes. In all confocal observations of exflagellating male gametocytes, myc-tagged MISFIT staining was confined within the parental gametocyte nucleus. The nuclear staining of MISFIT in zygotes and ookinetes resembled that in male gametocytes, with a broader pattern than that of the DNA staining and sometimes polarized or peripheral distribution.

Based on phenotype analyses of a mutant lacking expression of MISFIT (RMgm-321)it has been suggested that MISFIT is involved in the regulation of microtubule remodeling during DNA replication and chromosome segregation in mitosis in male gametocytes and/or meiosis in zygotes.

Other mutants
RMgm-321: A mutant lacking expression of MISFIT


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1038200
Gene Model P. falciparum ortholog PF3D7_1403800
Gene productnuclear formin-like protein MISFIT, putative | male-inherited sporulation factor important for transmission
Gene product: Alternative nameMISFIT, male-inherited sporulation factor important for transmission
Details of the genetic modification
Name of the tagc-myc
Details of taggingC-terminal
Additional remarks: taggingThe misfit gene was fused to a C-terminal myc tag by replacing 1 kb of the most 3′ terminal portion of the endogenous misfit locus with a double c-myc tagged counterpart.
Commercial source of tag-antibodiesRabbit anti-myc monoclonal antibody (71D10, New England Biolabs); Rat anti-myc antibody (JAC6, AbCam
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ClaI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe tagging vector carries a C-terminal fragment of pbmisfit, with a unique ClaI restriction site in its
centre, cloned in-frame with a double c-myc tag and in tandem with a tgdhfr/ts pyrimethamine-selection cassette. The construct is linearized by cutting with ClaI. Transfection of the linearized construct results in single homologous recombination and replacement of the last 942 bp of the native pbmisfit locus with its myc-tagged version.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCCAGAAGGAAGATTAAGTTGTATGG
Additional information primer 1misfit-myc F; Tagging 3’ target pbmisfit ApaI
Sequence Primer 2TTGGGCCCAGCAGAAGAATCAAATTCTGC
Additional information primer 2misfit-myc R; Tagging 3’ target pbmisfit KpnI
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6