RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-218
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0819900; Gene model (P.falciparum): PF3D7_0919000; Gene product: nucleosome assembly protein (NAPS, nucleosome assembly protein S; SET)
Name tag: GFP
Transgene
 Transgene Plasmodium: Gene model: PBANKA_0819900; Gene model (P.falciparum): PF3D7_0919000; Gene product: nucleosome assembly protein (NAPS, nucleosome assembly protein S; SET)
Promoter: Gene model: PBANKA_0819900; Gene model (P.falciparum): PF3D7_0919000; Gene product: nucleosome assembly protein (NAPS, nucleosome assembly protein S; SET)
3'UTR: Gene model: PBANKA_0819900; Gene product: nucleosome assembly protein (NAPS, nucleosome assembly protein S; SET)
Insertion locus: Gene model: Not available; Gene product: Not available (small subunit ribosomal rna gene (c-or d-type unit))
Phenotype Asexual bloodstage; Gametocyte/Gamete; Fertilization and ookinete; Oocyst;
Last modified: 2 August 2011, 10:31
  *RMgm-218
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 16677299
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone 8417HP
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (Janse et al., Exp. Parasitol. 68, 274-282).
top of page
The mutant parasite was generated by
Name PI/ResearcherT. Pace, M. Ponzi
Name Group/DepartmentDipartimento di Malattie Infettive Parassitarie ed Immunomediate
Name InstituteIstituto Superiore di Sanità
CityRome
CountryItaly
top of page
Name of the mutant parasite
RMgm numberRMgm-218
Principal nameA-SET/GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNAPS/SET-GFP expression in the nucleus of all asexual blood stages
Gametocyte/GameteNo GFP expression is observed in gametocytes.
Fertilization and ookineteLow NAPS/SET-GFP expression in the nucleus of ookinetes
OocystNAPS/SET-GFP expression is observed in oocysts.
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a c-terminal GFP-tagged form of NAPS/SET. The gfp-naps/set gene is under the control of the 'asexual blood stage promoter' (A-promoter) of naps/set (see 'Phenotype'). The gfp-naps/set gene is integrated into the non-essential c- or d-type ribosomal rna locus and has its own 3'-UTR region.
See also RMgm-217 for a mutant expressing gfp-naps/set gene  under the control of the 'gametocyte-specific promoter' (G-promoter) of naps/set (see 'Phenotype').

Protein (function)
Plasmodium contains two nucleosome assembly proteins, termed NAPL and NAPS (NAPS: PF1093c nucleosome binding protein; PBANKA_081990; NAPL: PFL0185c Nucleosome binding protein 1; PBANKA_060270). NAPL is predominantly localized in the cytoplasm, whereas NAPS has mainly a nuclear location. Both NAPS and NAPL interact with histones but only NAPS is able to deposit histones onto DNA.

Phenotype
The single-copy gene encoding NAPS/SET  produces mRNA transcripts in asexual blood stage parasites with a different size of the 5'UTR region compared with transcripts produced in gametocytes (Pace et al., 1998, Mol Biochem Parasitol. 97:45-53). This size difference is the result of post-transcriptional processing and the use of alternative transcription initiation sites. The phenotype analyses of this mutant and mutant RMgm-217  demonstrates the presence of two distinct promoters upstream of the naps/set gene, the one active in all asexual blood stage parasites (A-promoter) while the other is active only in gametocytes(G-promoter). In ookinetes both promoters exhibit a basal activity, while in the oocysts the gametocyte-specific promoter is silent and the reporter gene is only transcribed from the A-promoter.

Additional information
GenBank Accession No. of naps/set: AF031904.
Attempts to disrupt NAPL and NAPS of P. falciparum (Gill et al., 2009, J Biol Chem. 2009, Jan 27; Gill J. et al, 2010 Malar J) and NAPS of P. berghei (RMgm-246) were not successful, indicating an essential role during asexual blood stage development.

Other mutants
RMgm-217: A mutant expressing a c-terminal GFP-tagged form of NAPS/SET under the control of the 'gametocyte-specific promoter' (A-promoter) and introduced into the c/d-rrna locus
RMgm-246: Unsuccessful attempts to disrupt NAPS/SET

  Tagged: Mutant parasite with a tagged gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0819900
Gene Model P. falciparum ortholog PF3D7_0919000
Gene productnucleosome assembly protein
Gene product: Alternative nameNAPS, nucleosome assembly protein S; SET
top of page
Details of the genetic modification
Name of the tagGFP
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ApaI
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe single-copy gene encoding NAPS/SET produces mRNA transcripts in asexual blood stage parasites with a different size of the 5'UTR region compared with transcripts produced in gametocytes (Pace et al., 1998, Mol Biochem Parasitol. 97:45-53). This size difference is the result of post-transcriptional processing and the use of alternative transcription initiation sites. Two different transfection constructs have been generated that contained a C-terminal fusion between the entire coding region of the naps/set gene and the gfp reporter. Set/gfp was placed under the control of two of distinct promoter regions, i.e. the 1.3 kb fragment upstream of the gametocyte-specific mRNA (G-promoter; the distal promoter) or a 1.3 kb fragment upstream of the asexual mRNA (promoter-A; the proximal promoter) and the same 3'UTR. The two constructs (pG-SET/GFP and pA-SET/GFP respectively) also contained the P. berghei dhfr-ts as a selectable marker cassette and a fragment of the small subunit of the d-rrna gene of P. berghei for targeted integration into the non-essential c or d-rrna genes by a single-cross over event.
Construct pA-SET/GFP was used to generate the mutant described here and construct pG-SET/GFP was used to generate mutant RMgm-217
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GAATTCATGAAGAGAGATCGTTCAGA
Additional information primer 1Set coding region (EcoRI)
Sequence Primer 2CCCGGGATCATCATTATCTTTTCCATC
Additional information primer 2Set coding region (XmaI)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: Plasmodium
Gene Model of Parasite PBANKA_0819900
Gene Model P. falciparum ortholog PF3D7_0919000
Gene productnucleosome assembly protein
Gene product: Alternative nameNAPS, nucleosome assembly protein S; SET
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ApaI
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe single-copy gene encoding NAPS/SET produces mRNA transcripts in asexual blood stage parasites with a different size of the 5'UTR region compared with transcripts produced in gametocytes (Pace et al., 1998, Mol Biochem Parasitol. 97:45-53). This size difference is the result of post-transcriptional processing and the use of alternative transcription initiation sites. Two different transfection constructs have been generated that contained a C-terminal fusion between the entire coding region of the naps/set gene and the gfp reporter. Set/gfp was placed under the control of two of distinct promoter regions, i.e. the 1.3 kb fragment upstream of the gametocyte-specific mRNA (G-promoter; the distal promoter) or a 1.3 kb fragment upstream of the asexual mRNA (promoter-A; the proximal promoter) and the same 3'UTR. The two constructs (pG-SET/GFP and pA-SET/GFP respectively) also contained the P. berghei dhfr-ts as a selectable marker cassette and a fragment of the small subunit of the d-rrna gene of P. berghei for targeted integration into the non-essential c or d-rrna genes by a single-cross over event.
Construct pA-SET/GFP was used to generate the mutant described here and construct pG-SET/GFP was used to generate mutant RMgm-217
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_0819900
Gene Model P. falciparum ortholog PF3D7_0919000
Gene productnucleosome assembly protein
Gene product: Alternative nameNAPS, nucleosome assembly protein S; SET
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1GTCGACGTAATTTTTTCTCCACAT
Additional information primer 1A-fragment (SalI)
Sequence Primer 2GAATTCGCGCGCTTCTCTATAACAGTAAATTT
Additional information primer 2A-fragment (EcoRI)
top of page
3'-UTR
Gene Model of Parasite PBANKA_0819900
Gene productnucleosome assembly protein
Gene product: Alternative nameNAPS, nucleosome assembly protein S; SET
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1ACTAGTGATGATTAATAAATAAATTGATC
Additional information primer 13'UTR (SpeI)
Sequence Primer 2GCGGCCGCGATATCCCTCTAAGTAGCATT
Additional information primer 23'UTR (NotI)
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative namesmall subunit ribosomal rna gene (c-or d-type unit)
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GCGGCCGCCGGTCCAACCTGGTTGATCTTGCCAG
Additional information primer 1SSU (NotI)
Sequence Primer 2GAGCTCACTACGTGACCTACGGAAACCTTGTTACG
Additional information primer 2SSU (SacI)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren