RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-246
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_0819900; Gene model (P.falciparum): PF3D7_0919000; Gene product: nucleosome assembly protein (NAPS, nucleosome assembly protein S; SET)
PhenotypeNo phenotype has been described
Last modified: 27 July 2010, 09:37
  *RMgm-246
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 4
Reference (PubMed-PMID number) Not published (yet)
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherT. Pace, C.J. Janse
Name Group/DepartmentDipartimento di Malattie Infettive Parassitarie ed Immunomediate
Name InstituteIstituto Superiore di Sanità
CityRome
CountryItaly
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0819900
Gene Model P. falciparum ortholog PF3D7_0919000
Gene productnucleosome assembly protein
Gene product: Alternative nameNAPS, nucleosome assembly protein S; SET
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe unsuccessful attempts to disrupt NAPS/SET indicate an essential role of this protein during asexual blood stage development.
Disruption experiments were performed in the Leiden Malaria Research Group (exp. 921, 922; pl1239) and in Istituto Superiore di Sanità (Rome, Dr. T. Pace) using the same construct.
Plasmodium contains two nucleosome assembly proteins, termed NAPL and NAPS (NAPS (or SET): PF1093c nucleosome binding protein; PBANKA_081990; NAPL: PFL0185c Nucleosome binding protein 1; PBANKA_060270). NAPL is predominantly localized in the cytoplasm, whereas NAPS has mainly a nuclear location. Both NAPS and NAPL interact with histones but only NAPS is able to deposit histones onto DNA.
See also RMgm-217 and RMgm-218 for mutants expressing GFP-tagged versions of NAPS/SET under the control of different promoters.
Attempts to disrupt NAPL and NAPS of P. falciparum (Gill et al., 2009, J Biol Chem. 2009, Jan 27; Gill J. et al, 2010 Malar J) and NAPS of P. berghei (RMgm-246) were not successful, indicating an essential role during asexual blood stage development.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1gaccggtaccgaattcgggccccgagtctcattcctataaaac
Additional information primer 1gamB7-KO-5.1 (5')
Sequence Primer 2gaccctgcagctcgagatagtatattgccttccatctttt
Additional information primer 2gamB7-KO-5.2 (5')
Sequence Primer 3gaccGGTACCCGGGTAGATGATTAATAAATAAATTG
Additional information primer 3B7-KO-3.1 (3')
Sequence Primer 4gaccGCGGCCGCgatatccctctaagtagca
Additional information primer 4B7-KO-3.2
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: StudioDrie StudioDrie; S. Mededovic and A. van Wigcheren