Summary

RMgm-206
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1302800; Gene model (P.falciparum): PF3D7_1438900; Gene product: thioredoxin peroxidase 1 (TPx-1; Trx-Px1; TPx1: PfPRX-1)
Phenotype Gametocyte/Gamete; Sporozoite; Liver stage;
Last modified: 8 October 2014, 16:48
  *RMgm-206
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 16597467
Reference 2 (PMID number) : 18417228
Reference 3 (PMID number) : 25284813
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherK. Yano, S. Kawazu
Name Group/DepartmentResearch Institute
Name InstituteInternational Medical Center of Japan
CityTokyo
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-206
Principal namePrx-KO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteReduced production of gametocytes (60% fewer gametocytes compared to wild type)
Fertilization and ookineteNot tested
OocystNot different from wild type
SporozoiteNormal numbers of oocyst are produced. The number of mature oocysts containing sporozoites and the number of salivary gland sporozoites is reduced compared to wild type. Infectivity of salivary gland sporozoites is reduced as shown by a prolonged pre-patent period after intravenous inoculation of sporozoites.
Liver stageInfectivity of salivary gland sporozoites is reduced as shown by a prolonged pre-patent period after intravenous inoculation of sporozoites. Slightly reduced liver stage development.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of thioredoxin peroxidase 1 (TPx-1, typical 2-Cys peroxiredoxin).

Protein (function)
Peroxiredoxins (Prxs) constitute a family of proteins structurally homologous to the thiol-specific antioxidant of yeast. There are three subtypes of Prxs, 1-Cys Prx, typical 2-Cys Prx, and atypical 2-Cys Prx. 2-Cys Prxs have been found to act as a terminal peroxidase that reduces hydrogen peroxide and organic hydroperoxides with the use of electrons donated by the thioredoxin (Trx) system. Plasmodium contains 1-Cys Prx and two typical 2-Cys Prxs; TPx-1 (cytosolic) and TPx-2 (mitochondrial); see also 'Additional information').

Phenotype
The phenotype analyses are described in three/four (!!) papers (see references, PMID numbers above and reference given below). These analyses indicate that TPx-1 is not essential for parasite development during blood stage development, mosquito development and development in the liver. The analyses indicate that the lack of expression of TPx-1 has an (slight) effect on gametocyte production, oocyst development, sporozoite infectivity and development of liver stages. Evidence is presented for a slightly reduced liver stage development.

See also the paper: Turturice BA et al., 2013 PloS Pathogen 9(1): e1003136. In this paper they analysed 1-Cys Prx (PBANKA_122800) expression in the TPx-1 knock-out parasites.

Additional information
The effect on gametocyte production, as described in the first paper, has been determined in vivo in asynchronous infections in mice. No detailed information is further provided on the effect on gametocytes or on fertilisation and ookinete development/production. In the second paper, mice are used to infect mosquitoes that have 'high' numbers of gametocytes. Electron microscope analysis of mature oocysts showed damaged oocysts with 'irregular sporogonic development'. No quantitative data is provided on the damaged oocysts.
 
In most eukaryotic organisms, redox-active enzymes, such as catalase, superoxide dismutase, and peroxidases as well as an enzymatic cascade that generates reduced electron donors, i.e. glutathione (GSH) and thioredoxin (Trx), sustain the cellular redox homeostasis. This redox network is split into two major arms, the GSH and the Trx system, that serve complementary functions in antioxidant defence and DNA synthesis. The malarial parasite Plasmodium lacks two central antioxidant enzymes: (i) catalase that typically detoxifies hydrogen peroxide and (ii) a classical glutathione peroxidase, a selenoenyzme that reduces lipid hydroperoxides to their alcohols. This apparent deficiency  underscores the possible central importance of the thioredoxin system in the parasite. 

See also mutant RMgm-791 which lacks expression of the 2-Cys peroxiredoxin, thioredoxin peroxidase 2 (TPx-2)

Other mutants
RMgm-791: A mutant lacking expression of thioredoxin peroxidase 2 (TPx-2)
RMgm-586: A mutant lacking expression of thioredoxin reductase (TrxR)


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1302800
Gene Model P. falciparum ortholog PF3D7_1438900
Gene productthioredoxin peroxidase 1
Gene product: Alternative nameTPx-1; Trx-Px1; TPx1: PfPRX-1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption Both targeting regions contain part of the coding sequence
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGGCCCTCACCAGCCTTATTAAG
Additional information primer 1(ApaI); 5'
Sequence Primer 2CCCCCGTCGACAATATATTTCTTTCC
Additional information primer 2(HincII); 5'
Sequence Primer 3CGGAATTCCGAGTTTGTAAAAGAAC
Additional information primer 3(EcoRI); 3'
Sequence Primer 4TTCTGCAGTCATTTAAAATAAAG
Additional information primer 4(PstI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6