Back to search resultsSummaryRMgm-204
|
||||||||
*RMgm-204| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene disruption |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 19229315 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 507cl1 (RMgm-7) |
| Other information parent line | P.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter (PubMed: PMID: 16242190). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | J. Vega-Rodriguez, C.J. Janse, A.E. Serrano |
| Name Group/Department | Department of Microbiology and Medical Zoology |
| Name Institute | University of Puerto Rico, School of Medicine |
| City | San Juan |
| Country | Puerto Rico |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-204 |
| Principal name | 866cl1; 985cl1 |
| Alternative name | pbggcs−1; pbggcs−2 |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Blood stages show a small decrease in the growth rate in mice. |
| Gametocyte/Gamete | Not different from wild type |
| Fertilization and ookinete | Normal gametocyte production. The ookinete production in Anopheles stephensi mosquitoes was reduced by 30-40% as compared to wild type parasites. Ookinetes had a reduced capacity to develop into (mature) oocysts. |
| Oocyst | Ookinetes had a reduced capacity to develop into (mature) oocysts. At two days after feeding of mosquitoes the number of young oocysts (stained with anti-P28 antibodies) was reduced by 70-90% when compared to wild type. At day 12 after feeding the oocysts numbers were reduced by 65-85%. Day 12 oocysts were significantly smaller than wild type oocysts and no formation of sporozoites was observed. |
| Sporozoite | No formation of sporozoites |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation Protein (function) Phenotype Additional information See also mutants RMgm-403 and RMgm-404 that lack expression of glutathione reductase (GR). Phenotype analyses of these mutants indicate that similar to what was reported for γ-GCS, GR is not essential for parasite blood stage development but it does play a critical role during oocyst development in the mosquito Other mutants |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0819800 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0918900 | ||||||||||||||||||||||||
| Gene product | gamma-glutamylcysteine synthetase | ||||||||||||||||||||||||
| Gene product: Alternative name | γ-GCS | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() AGCTTGCATGCCTGCAGGTCAACAATAAATAATAAATAAATATTGTGGAAATAAAATAAC
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | KpnI/SacII | ||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | |||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||