Summary

RMgm-186
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0902100; Gene model (P.falciparum): PF3D7_1147000; Gene product: sporozoite and liver stage asparagine-rich protein | sporozoite asparagine-rich protein (SAP1, SLARP; sporozoite (and liver stage) asparagine-rich protein; S22)
Name tag: mCherry
Phenotype Sporozoite;
Last modified: 8 March 2009, 20:58
  *RMgm-186
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18551171
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 507cl1 (RMgm-7)
Other information parent lineP.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherO. Silvie; K. Matuschewski
Name Group/DepartmentDepartment of Parasitology
Name InstituteHeidelberg University School of Medicine
CityHeidelberg
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-186
Principal nameslarp/mcherry
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteSporozoites show (a weak) mCherry-fluorescence associated with the nucleus of sporozoites
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses an mCherry-tagged form of SLARP (sporozoite and liver stage asparagine-rich protein; SAP1, sporozoite asparagine-rich protein; S22).

Protein (function)
SLARP was first identified as a sporozoite-expressed gene in a suppression subtractive hybridization (SSH) screen of P.  yoelii salivary gland sporozoites versus blood-stage merozoites (designated S22, sporozoite-specific gene 22).
See RMgm-172 and RMgm-185 for mutants lacking expression of SLARP/SAP1.

Phenotype
Sporozoites show (a weak) mCherry-fluorescence associated with the nucleus of sporozoites (see also 'Additional information'). No fluorescence was detected in blood stages and oocysts.

Additional information
The nucleus associated fluorescence indicates a nuclear location of SLARP/SAP1.
In an independent study IFA analysis using antibodies against SAP1 a specific sporozoite-internal staining was observed that excluded the nucleus and was distinct from circumsporozoite (CS) protein staining, suggesting a cytoplasmic location (see RMgm-172).

Other mutants
RMgm-172, RMgm-185: Mutants lacking expression of SAP1/SLARP


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0902100
Gene Model P. falciparum ortholog PF3D7_1147000
Gene productsporozoite and liver stage asparagine-rich protein | sporozoite asparagine-rich protein
Gene product: Alternative nameSAP1, SLARP; sporozoite (and liver stage) asparagine-rich protein; S22
Details of the genetic modification
Name of the tagmCherry
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid HpaI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ATAAGAATGCGGCCGCTATGAGAAATACTGGGAATACCATTGAAGG
Additional information primer 1SLARPtagfor (NotI)
Sequence Primer 2GGACTAGTATAAAATAAGAATCGATTCATTATTTCAAAATTTATATGG
Additional information primer 2SLARPtagrev (SpeI)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6