RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-172
Malaria parasiteP. yoelii
Genotype
DisruptedGene model (rodent): PY17X_0903500; Gene model (P.falciparum): PF3D7_1147000; Gene product: sporozoite and liver stage asparagine-rich protein | sporozoite asparagine-rich protein (SAP1, SLARP; sporozoite (and liver stage) asparagine-rich protein; S22)
Phenotype Sporozoite; Liver stage;
Last modified: 10 February 2011, 18:53
  *RMgm-172
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18466298
Reference 2 (PMID number) : 21299648
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone clone 1.1
Other information parent line17XNL is a non-lethal strain of P. yoelii
top of page
The mutant parasite was generated by
Name PI/ResearcherA.S.I. Aly; S.H.I. Kappe
Name Group/DepartmentSeattle Biomedical Research Institute
Name InstituteNot applicable
CitySeattle
CountryUSA
top of page
Name of the mutant parasite
RMgm numberRMgm-172
Principal namesap1(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of salivary gland sporozoites are formed. Sporozoites lack sap1 transcripts. Infection of mice by mosquito bite or by inoculation of salivary gland sporozoites did not result in a blood stage infection. Sporozoites show normal gliding, hepatocyte traversal and invasion in vitro.
Liver stageInfection of mice by mosquito bite or by inoculation of salivary gland sporozoites did not result in a blood stage infection. Sporozoites show normal gliding, hepatocyte traversal and invasion in vitro. In vitro in HepG2-CD81 cells the number of developing liver stages gradually decrease between 6 and 12h after infection and sharply decrease between 18 and 24h after infection. In addition, the liver stages failed to growth and develop.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of SAP1 (sporozoite asparagine-rich protein; S22; SLARP, sporozoite and liver stage asparagine-rich protein).

Protein (function)
SAP1 was first identified as a sporozoite-expressed gene in a suppression subtractive hybridization (SSH) screen of P.  yoelii salivary gland sporozoites versus blood-stage merozoites (designated S22, sporozoite-specific gene 22).

Phenotype
The phenotype analyses indicate an essential role during the transformation of the sporozoite into the liver trophozoite within the hepatocyte and mutant parasites show a complete attenuation of liver stage development.  Mutant salivary gland sporozoites showed strongly reduced transcript abundance for several genes encoding proteins that play a role in infection of the liver, UIS3, UIS4 and P52 but not SPECTs, TRAP and CSP, indicating a selective mechanism of UIS transcript depletion. Based on these observations and its cytoplasmic location it has been suggested that SAP1 plays a role in translational repression of transcripts in sporozoites. See also 'Additional Information'  for a possible different function of SAP1 and additional analyses of the phenotype of this mutant described by Aly, A.S et al. (2011; Mol. Microbiol. 79, 929-39).

Additional information
No parasitophorous vacuole membrane (PVM) could be detected using antibodies against UIS4. Electron microscope analysis showed the presence of the PVM in a number of parasites.
Immunization of mice with the attenuated sporozoites of the mutant parasites induced protective immune responses against challenge with wild type parasites. See also RMgm-185, a P. berghei mutant lacking expression of SAP1/SLARP. Immunization with  sporozoites of this P. berghei  mutant confers only limited protective immunity.

By IFA analysis using antibodies against SAP1 a specific sporozoite-internal staining was observed that excluded the nucleus and was distinct from circumsporozoite (CS) protein staining, suggesting a cytoplasmic location.

See also the phenotype description of mutant RMgm-185 lacking expression of SAP1/SLARP and mutant RMgm-186 expressing an mCherry tagged version of SAP1/SLARP. For these mutants a nuclear location of SAP1/SLARP has been reported. Based on these observations it has been suggested that SAP1/SLARP functions as a specific regulator of the expression of genes involved at early steps of liver stage development

GenBank Accession No: EU652769.

Other mutants
RMgm-185: An independent mutant lacking expression of SAP1/SLARP
RMgm-186: A mutant expressing an mCherry tagged form of SAP1/SLARP

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PY17X_0903500
Gene Model P. falciparum ortholog PF3D7_1147000
Gene productsporozoite and liver stage asparagine-rich protein | sporozoite asparagine-rich protein
Gene product: Alternative nameSAP1, SLARP; sporozoite (and liver stage) asparagine-rich protein; S22
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI/SacII
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption Part of the 3' coding sequence of the gene remained in the genome after the disruption event (see figure 3.A: A.S.I. Aly et al., Mol Microbiol, 2008, 69: 152-163).
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCGTGCAATGTGAAAATGATAATGCTCGATAAG
Additional information primer 1PySAP1rep1F (KpnI); 5'UTR
Sequence Primer 2GCCCAAGCTTTTTTCTTTCTTAAATACAAAAAAATAATTTAT
Additional information primer 2PySAP1rep2R (HindIII); 5'UTR
Sequence Primer 3GGACTAGTCCAGCTATAAACTCCGAAACATCGAATTATGT
Additional information primer 3PySAP1rep3F (SpeI); 3'ORF
Sequence Primer 4TCCCCGCGGGCATCGCGTTGATGCTTTTGGGAATTATTGA
Additional information primer 4PySAP1rep4R (SacII); 3'ORF
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren