Summary

RMgm-185
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0902100; Gene model (P.falciparum): PF3D7_1147000; Gene product: sporozoite and liver stage asparagine-rich protein | sporozoite asparagine-rich protein (SAP1, SLARP; sporozoite (and liver stage) asparagine-rich protein; S22)
Phenotype Sporozoite; Liver stage;
Last modified: 9 March 2009, 09:26
  *RMgm-185
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18551171
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 507cl1 (RMgm-7)
Other information parent lineP.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherO. Silvie; K. Matuschewski
Name Group/DepartmentDepartment of Parasitology
Name InstituteHeidelberg University School of Medicine
CityHeidelberg
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-185
Principal nameslarp(-)cl1; slarp(-)cl3
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of salivary gland sporozoites are formed. Infection of mice by mosquito bite or by inoculation of salivary gland sporozoites did not result in a blood stage infection. Sporozoites show normal hepatocyte traversal and invasion in vitro.
Liver stageInfection of rats and mice by mosquito bite or by inoculation of salivary gland sporozoites did not result in a blood stage infection. Sporozoites show normal hepatocyte traversal and invasion in vitro.
The number of infected hepatocytes decreased over time in vitro. Mutant liver stages remained very small throughout the culture time, around 3–4 µm, which roughly corresponds to the size of 12–18h wild type parasites. Most mutant parasites were blocked at the one nucleus stage, even at late time points of infection.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of SLARP (sporozoite and liver stage asparagine-rich protein; SAP1, sporozoite asparagine-rich protein; S22).

Protein (function)
SLARP was first identified as a sporozoite-expressed gene in a suppression subtractive hybridization (SSH) screen of P.  yoelii salivary gland sporozoites versus blood-stage merozoites (designated S22, sporozoite-specific gene 22).

Phenotype
The phenotype analyses indicate an essential role during the transformation of the sporozoite into the liver trophozoite within the hepatocyte. The lack of expression of SLARP/SAP1  results in complete loss of sporozoite infectivity to rodents, due to early developmental arrest after invasion of hepatocytes. Mutant sporozoites productively invade host cells by forming a parasitophorous vacuole (PV), but subsequent remodelling of the membrane of the PV (PVM) is impaired as a consequence of down-regulation of genes encoding PVM-resident proteins.
Mutant salivary gland sporozoites showed strongly reduced transcript abundance for several genes encoding proteins that play a role in infection of the liver (UIS3, UIS4). Based on these observations and its association with the nucleus it has been suggested that SAP1 plays a role in translational repression of transcripts in sporozoites. See also 'Additional Information'  for a possible different function of SLARP/SAP1.

Additional information
Staining with the cholesterol-binding agent filipin confirmed the presence of a parasitophorous vacuole membrane (PVM) in infected hepatocytes invaded by the mutant sporozoites. By IFA analysis only very weak internal staining was observed with antibodies against UIS4 and no staining with EXP1 antibodies, indicating that remodelling of the PVM is impaired.

Immunization of mice with the attenuated sporozoites of the mutant parasites induced only limited protective immune responses against challenge with wild type parasites. See also RMgm-185, a P. yoelii mutant lacking expression of SAP1/SLARP. Immunization with P. yoelii mutant sporozoites induces strong protective immunity.

Using a mutant that expresses an mCherry tagged version of SAP1/SLARP (RMgm-186) a nuclear location/association of SLARP/SAP1 was observed. Based on these observations it has been suggested that SAP1/SLARP functions as a specific regulator of the expression of genes involved at early steps of liver stage development.
See also the phenotype description of mutant RMgm-172 lacking expression of SAP1/SLARP By IFA analysis using antibodies against SAP1 a specific sporozoite-internal staining was observed that excluded the nucleus and was distinct from circumsporozoite (CS) protein staining, suggesting a cytoplasmic location. Based on these observations and its cytoplasmic location it has been suggested that SAP1 plays a role in translational repression of transcripts in sporozoites.

Genbank accession no. EU579524.

Other mutants
RMgm-172: An independent mutant lacking expression of SAP1/SLARP
RMgm-186: mutant expressing mCherry tagged SAP1/SLARP


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0902100
Gene Model P. falciparum ortholog PF3D7_1147000
Gene productsporozoite and liver stage asparagine-rich protein | sporozoite asparagine-rich protein
Gene product: Alternative nameSAP1, SLARP; sporozoite (and liver stage) asparagine-rich protein; S22
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SacII/KpnI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption A small fragment of both the 5'-, and 3' coding sequence of SLARP remained in the genome after the disruption of the gene (159bp and 165bp respectively)
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TCCCCGCGGCTAACGCATATACCTATGATTCAGGACG
Additional information primer 1SLARPrep1for (SacII); 5'
Sequence Primer 2ATAAGAATGCGGCCGCGTTATGTATTTTTGTAAGAACTATTAAACC
Additional information primer 2SLARPrep2rev (NotI); 5'
Sequence Primer 3CCCAAGCTTCTTCACAAATATAATCAAACTTAGAACTGC
Additional information primer 3SLARPrep3for (HindIII); 3'
Sequence Primer 4CGGGGTACCGAACTTCAAAATCATCCATATTATATCC
Additional information primer 4SLARPrep4for (KpnI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6