Summary

RMgm-163
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0907100; Gene model (P.falciparum): PF3D7_1141900; Gene product: inner membrane complex protein 1b, putative (IMC1b, inner membrane complex protein 1b)
Name tag: EGFP
Phenotype Fertilization and ookinete; Oocyst;
Last modified: 15 January 2011, 22:14
  *RMgm-163
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18650444
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherA.Z. Tremp; J.T. Dessens
Name Group/DepartmentDepartment of Infectious and Tropical Diseases
Name InstituteLondon School of Hygiene and Tropical Medicine
CityLondon
CountryUnited Kingdom
Name of the mutant parasite
RMgm numberRMgm-163
Principal nameIMC1b/GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteVery weak cytoplasmic GFP-fluorescence was observed in macrogametes and zygotes. As the ookinete develops by forming a protrusion of the spherical zygote, a developmental stage called retort, strong fluorescence became localized to the periphery of the protrusion corresponding to the newly forming ookinete but not to the zygote part of the retort.
OocystOokinete-to-oocyst transformation starts with the development of a round protrusion midway along the ookinete, a developmental stage called took. These protrusions were devoid of peripheral GFP-fluorescence , indicating that IMC1b is absent from this part of the cell. As the rounding-up process of the ookinete completes, young spherical oocysts form; these displayed peripheral fluorescence only in part of the cell. However, older multinucleate oocysts no longer displayed any fluorescence indicating loss of IMC1b containing structures.
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant expresses a C-terminal GFP-tagged version of IMC1b (inner membrane complex protein 1b).

Protein (function)
The imcb1b gene belongs to small 'family' of conserved genes that express putative membrane skeleton proteins which contain domains that share sequence homology to domains of articulins, proteins of membrane skeleton of free-living protists and show homology to the inner membrane complex protein 1 (TgIMC1) of the subpellicular network of Toxoplasma gondii tachyzoites (Khater, E.I., et al. 2004, J. Cell. Biol. 167, 425-32) . See also the phenotype analyses of the mutant  RMgm-147 lacking expression of IMC1b. 

Phenotype
The phenotype analyses indicate that expression of IMC1b occurs predominantly in the (developing) ookinete stage.
As the ookinete develops by forming a protrusion of the spherical zygote, a developmental stage called retort, strong fluorescence became localized to the periphery of the protrusion corresponding to the newly forming ookinete but not to the zygote part of the retort . These observations argue against the targeting of IMC1b to the plasma membrane; in this scenario the protein would be localized to the periphery of entire retort, which is not the case. The localized peripheral fluorescence did not extend all the way to the anterior end of the developing ookinetes. These observations are consistent with a localization of IMC1b to the ookinete pellicle structure, which support the prediction that IMC1b is a membrane skeleton protein.
See also the phenotype analyses of the mutant  RMgm-147 lacking expression of IMC1b. 

Additional information

Other mutants
RMgm-147: A mutant lacking expression of IMC1b
RMgm-148: A mutant lacking expression of IMC1a (inner membrane complex protein 1a)
RMgm-600: A mutant expressing a GFP-tagged form of IMC1h
RMgm-601: A mutant lacking expression of IMC1h
RMgm-602: A mutant lacking expression of both IMC1h and IMCb


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0907100
Gene Model P. falciparum ortholog PF3D7_1141900
Gene productinner membrane complex protein 1b, putative
Gene product: Alternative nameIMC1b, inner membrane complex protein 1b
Details of the genetic modification
Name of the tagEGFP
Details of taggingC-terminal
Additional remarks: taggingAchieved by replacing the native imc1b allele by double homologous crossover recombination with a recombinant imc1b gene linked to the egfp coding sequence. Concomitantly, a modified T. gondii dihydrofolate reductase (tgdhfr) gene cassette, which confers resistance to the antimalarial drug pyrimethamine, was introduced.
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI/SacII
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTo facilitate the generation of DNA constructs that allowed the GFP tagging of imc1b via double crossover homologous recombination, a dual plasmid system was designed and constructed. The first plasmid, pDNR-EGFP, is derived from pDNR-Dual (BD Biosciences) and was modified to contain the coding sequence for enhanced GFP (EGFP) followed by a "generic" 3'-UTR derived from pbdhfr. This plasmid also contains the chloramphenicol resistance gene without a bacterial promoter. These combined sequences are flanked by two loxP sites. The second plasmid, pLP-DHFR2, is derived from pBS-DHFR and was modified to contain a modified tgdhfr gene (conferring resistance to the antimalarial drug pyrimethamine) flanked upstream by the promoter sequence of pbdhfr and downstream by the 3'-UTR of pbsr. This plasmid also contains the loxP promoter cassette (BD Biosciences) containing a single loxP site followed by a bacterial promoter. The ensuing generation of the DNA construct for GFP tagging of IMC1b involved three steps. In the first step, the coding sequence plus 5'-UTR of imc1b was PCR-amplified and introduced into pDNR-EGFP upstream of, and in-frame with, the egfp sequence. A unique KpnI restriction site was introduced upstream of the imc1b sequence during PCR. In the second step, the 3'-UTR of imc1b was PCR-amplified and introduced in pLP-DHFR2 downstream of the tgdhfr cassette. In the third step, the imc1b sequence contained within pDNR-EGFP was transferred by Cre-lox site-specific recombination to the pLP-vector containing the imc1b-specific 3'-UTR. This recombination event places the chloramphenicol resistance gene present in the pDNR vector downstream of the bacterial promoter present in pLP vector, allowing antibiotic selection of desired recombinants.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ACGAAGTTATCAGTCGACGGTACCATTGAGACGTTACGTATTAATTGTG
Additional information primer 1pDNR-IMC1b-F (imc1b 5'utr + coding sequence)
Sequence Primer 2ATGAGGGCCCCTAAGCTTGTATTTGTTTTCAATTGAGAAATGG
Additional information primer 2pDNR-IMC1b-R (imc1b 5'utr + coding sequence)
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6