top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PBANKA_0907100
|
Gene Model P. falciparum ortholog |
PF3D7_1141900
|
Gene product | inner membrane complex protein 1b, putative |
Gene product: Alternative name | IMC1b, inner membrane complex protein 1b |
top of page |
Details of the genetic modification |
Name of the tag | EGFP |
Details of tagging | C-terminal |
Additional remarks: tagging | Achieved by replacing the native imc1b allele by double homologous crossover recombination with a recombinant imc1b gene linked to the egfp coding sequence. Concomitantly, a modified T. gondii dihydrofolate reductase (tgdhfr) gene cassette, which confers resistance to the antimalarial drug pyrimethamine, was introduced. |
Commercial source of tag-antibodies | |
Type of plasmid/construct | Plasmid double cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
KpnI/SacII
|
Selectable marker used to select the mutant parasite | tgdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | To facilitate the generation of DNA constructs that allowed the GFP tagging of imc1b via double crossover homologous recombination, a dual plasmid system was designed and constructed. The first plasmid, pDNR-EGFP, is derived from pDNR-Dual (BD Biosciences) and was modified to contain the coding sequence for enhanced GFP (EGFP) followed by a "generic" 3'-UTR derived from pbdhfr. This plasmid also contains the chloramphenicol resistance gene without a bacterial promoter. These combined sequences are flanked by two loxP sites. The second plasmid, pLP-DHFR2, is derived from pBS-DHFR and was modified to contain a modified tgdhfr gene (conferring resistance to the antimalarial drug pyrimethamine) flanked upstream by the promoter sequence of pbdhfr and downstream by the 3'-UTR of pbsr. This plasmid also contains the loxP promoter cassette (BD Biosciences) containing a single loxP site followed by a bacterial promoter. The ensuing generation of the DNA construct for GFP tagging of IMC1b involved three steps. In the first step, the coding sequence plus 5'-UTR of imc1b was PCR-amplified and introduced into pDNR-EGFP upstream of, and in-frame with, the egfp sequence. A unique KpnI restriction site was introduced upstream of the imc1b sequence during PCR. In the second step, the 3'-UTR of imc1b was PCR-amplified and introduced in pLP-DHFR2 downstream of the tgdhfr cassette. In the third step, the imc1b sequence contained within pDNR-EGFP was transferred by Cre-lox site-specific recombination to the pLP-vector containing the imc1b-specific 3'-UTR. This recombination event places the chloramphenicol resistance gene present in the pDNR vector downstream of the bacterial promoter present in pLP vector, allowing antibiotic selection of desired recombinants. |
Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | ACGAAGTTATCAGTCGACGGTACCATTGAGACGTTACGTATTAATTGTG |
Additional information primer 1 | pDNR-IMC1b-F (imc1b 5'utr + coding sequence) |
Sequence Primer 2 | ATGAGGGCCCCTAAGCTTGTATTTGTTTTCAATTGAGAAATGG |
Additional information primer 2 | pDNR-IMC1b-R (imc1b 5'utr + coding sequence) |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
Sequence Primer 5 | |
Additional information primer 5 | |
Sequence Primer 6 | |
Additional information primer 6 | |
|
|
top of page |