RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1417
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0819800; Gene model (P.falciparum): PF3D7_0918900; Gene product: gamma-glutamylcysteine synthetase (γ-GCS)
Phenotype Asexual bloodstage;
Last modified: 20 March 2016, 15:12
  *RMgm-1417
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 26953195
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherSongsungthong W; Kamchonwongpaisan S
Name Group/DepartmentNational Center for Genetic Engineering and Biotechnology (BIOTEC)
Name InstituteNational Science and Technology Development Agency (NSTDA)
CityPathum Thani
CountryThailand
Name of the mutant parasite
RMgm numberRMgm-1417
Principal nameΔgcs
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageReduced growth of asexual blood stages in mice
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of gamma-glutamylcysteine synthetase (γ-GCS).

Protein (function)
γ-GCS catalyzes the rate limiting step during GSH biosynthesis. GSH is a thiol-based tripeptide implicated in a variety of cellular processes, including detoxification of xenobiotics and protection against reactive oxygen species

In most eukaryotic organisms, redox-active enzymes, such as catalase, superoxide dismutase, and peroxidases as well as an enzymatic cascade that generates reduced electron donors, i.e. glutathione (GSH) and thioredoxin (Trx), sustain the cellular redox homeostasis. This redox network is split into two major arms, the GSH and the Trx system, that serve complementary functions in antioxidant defense and DNA synthesis. The malarial parasite Plasmodium lacks two central antioxidant enzymes: (i) catalase that typically detoxifies hydrogen peroxide and (ii) a classical glutathione peroxidase, a selenoenyzme that reduces lipid hydroperoxides to their alcohols. This apparent deficiency raises doubts about the relevance of the glutathione (GSH) pathway in detoxification of oxidative stress in Plasmodium. However, supportive of a role for GSH metabolism in the detoxification process are the observations that the P. falciparum glutathione S-tranferase enzyme, which conjugates GSH to other molecules via the sulfhydryl group, displays peroxidase activity.

Evidence has been presented that P. falciparum does not utilize GSH from the host red blood cell since the parasite membrane is neither permeable to host GSH nor γ-glutamylcysteine. Plasmodium is therefore thought to be dependent on its own GSH biosynthetic pathway. GSH is synthesized in Plasmodium by consecutive reactions facilitated by the enzymes γ-glutamylcysteine synthetase (γ-GCS) and glutathione synthetase (GS). However, it has been hypothesized that host GSH can be transported into the P. berghei food vacuole via hemoglobin-containing endocytic vesicles, based on data showing that GSH can detoxify the toxic ferriprotoporphyrin IX inside the parasite's food vacuole.

See also mutants RMgm-403 and RMgm-404 that lack expression of glutathione reductase (GR). Phenotype analyses of these mutants indicate that similar to what was reported for γ-GCS, GR is not essential for parasite blood stage development but it does play a critical role during oocyst development in the mosquito

Phenotype
Reduced growth of asexual blood stages in mice.

Additional information
Analyses are presented on the drug-sensitivity of mutants lacking γ-GCS (see for such studies also mutant RMgm-1418 and Vega-Rodriguez J et al. 2015. Implications of Glutathione Levels in the Plasmodium berghei Response to Chloroquine and Artemisinin. PLoS One 10:e0128212). 

Other mutants
See mutant RMgm-204 for an independent mutant lacking expression of γ-GCS.
RMgm-1418: A mutant over-expressing γ-GCS
RMgm-403, RMgm-404: Mutants lacking expression of glutathione reductase (GR).


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0819800
Gene Model P. falciparum ortholog PF3D7_0918900
Gene productgamma-glutamylcysteine synthetase
Gene product: Alternative nameγ-GCS
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 15′ ctactgaagcttccatggcgtacatgtacgcatatattataca 3′
Additional information primer 15′ ctactgaagcttcaggagtccaatgggatcc 3′
Sequence Primer 25′ ctactgcttaagggaaaaggtgaaattgctcctc 3′
Additional information primer 25′ ctactgggcgccggtgtgtatataccaaaccgtttc 3′
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6