SummaryRMgm-109
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene disruption |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 18974882 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA 507cl1 (RMgm-7) |
Other information parent line | P.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter (PubMed: PMID: 16242190). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | E. Lasonder, C.J. Janse, H.G. Stunnenberg |
Name Group/Department | Department of Molecular Biology |
Name Institute | NCMLS, Radboud University Nijmegen |
City | Nijmegen |
Country | The Netherlands |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-109 |
Principal name | 806; 841cl1 |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Not different from wild type |
Oocyst | Oocyst production is normal. Sporozoites are formed within the oocysts. Sporozoites fail to egress from the oocysts (see phenotype 'Sporozoite'). |
Sporozoite | Sporozoites are formed within the oocysts. Sporozoites fail to egress from the oocysts: very few sporozoites were detected in the hemocoel and salivary glands of infected A. stephensi (mean of 375 sporozoites per salivary gland compared to over 10.000 in wild type). |
Liver stage | Sporozoites fail to egress from the oocysts. No blood stage infections developed when mice were infected by bite of infected mosquitoes. Sporozoites collected from oocysts by liberating them using mechanical rupture were infectious to C57Bl/6 mice after intravenous injection (1–2x10(6)) sporozoites comparable to wild type oocyst-derived sporozoites. Oocyst-extracted sporozoites showed in vitro hepatocyte HepG2) traversal and invasion that was not significantly lower than sporozoites from wild type oocyst derived-sporozoites. |
Additional remarks phenotype | Mutant/mutation Protein (function) See also the phenotype analyses of mutants RMgm-233 and RMgm-234 which indicate that sporozoites lacking expression of SIAP-1are affected in motility and infectivity. |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1006200 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0408600 | ||||||||||||||||||||||||
Gene product | sporozoite invasion-associated protein 1 | ||||||||||||||||||||||||
Gene product: Alternative name | Sporozoite Invasion-Associated Protein-1; SIAP-1; SIAP-1/ag17/S5 | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map |
![]() | ||||||||||||||||||||||||
Plasmid/construct sequence |
![]() ![]() AGCTTGCATGCCTGCAGGTCAACAATAAATAATAAATAAATATTGTGGAAATAAAATAAC
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | See for more information about the disruption Lasonder, E. et al., 2008, PloS Pathogens 10, e10000195 (Supporting Information: S3). | ||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | See for more information about the disruption Lasonder, E. et al., 2008, PloS Pathogens 10, e10000195 (Supporting Information: S3). | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
![]()
| |||||||||||||||||||||||||
top of page |