RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-957
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1129800; Gene model (P.falciparum): PF3D7_0601600; Gene product: tetratricopeptide repeat protein, putative
Transgene
 Transgene not Plasmodium: mCherry
Promoter: Gene model: PBANKA_1129800; Gene model (P.falciparum): PF3D7_0601600; Gene product: tetratricopeptide repeat protein, putative
3'UTR: Gene model: PBANKA_1426700; Gene product: dihydropteroate synthetase, putative (DHPS; PPPK)
Replacement locus: Gene model: PBANKA_1129800; Gene product: tetratricopeptide repeat protein, putative
Transgene
 Transgene not Plasmodium: GFP
Promoter: Gene model: PBANKA_0711900; Gene model (P.falciparum): PF3D7_0818900; Gene product: heat shock protein 70 (HSP70)
3'UTR: Gene model: PBANKA_1340000; Gene product: dihydrofolate synthase/folylpolyglutamate synthase, putative (Dhfs-fpgs)
Replacement locus: Gene model: PBANKA_1129800; Gene product: tetratricopeptide repeat protein, putative
PhenotypeNo phenotype has been described
Last modified: 27 July 2015, 18:42
  *RMgm-957
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene, Introduction of a transgene
Reference (PubMed-PMID number) Not published (yet)
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
top of page
The mutant parasite was generated by
Name PI/ResearcherKooij, T.W.A.
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
top of page
Name of the mutant parasite
RMgm numberRMgm-957
Principal namePB383i
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of PBANKA_112980 (tetratricopeptide repeat protein, putative; TPR) and expresses mCherry under the control of the tpr promoter and expresses GFP under the control of the constitutive hsp70 promoter

Protein (function)

Phenotype
The phenotype has not been analysed in detail. However, blood and mosquito development was simliar to wild type parasites and parasites could be transmitted by mosquito bite.  Strong mCherry signal in females, weaker in males

Additional information

Other mutants
RMgm-956: an independent mutant lacking expression of PBANKA_112980 (TPR)
RMgm-958; RMgm-959: mutants expressing tagged versions of PBANKA_112980 (TPR)

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1129800
Gene Model P. falciparum ortholog PF3D7_0601600
Gene producttetratricopeptide repeat protein, putative
Gene product: Alternative name
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationAn intermediate pBAT-derived vector was used (see RMgm-757)
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TTTGCGGCCGCTTTGTAAAATACCGCTTAAATTATTTCC
Additional information primer 1Pb0107
Sequence Primer 2TTTGAATTCAATTTCCTAAGCCACTATGTGC
Additional information primer 2Pb0009
Sequence Primer 3AAGAAGCTTCGAAATAAACTTCATACATTTGTGC
Additional information primer 3Pb0028
Sequence Primer 4TTTGGTACCTCTTTGGGATAGTTAAACAAAATCG
Additional information primer 4Pb0029
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene namemCherry
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationAn intermediate pBAT-derived vector was used (see RMgm-757)
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_1129800
Gene Model P. falciparum ortholog PF3D7_0601600
Gene producttetratricopeptide repeat protein, putative
Gene product: Alternative name
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite PBANKA_1426700
Gene productdihydropteroate synthetase, putative
Gene product: Alternative nameDHPS; PPPK
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_1129800
Gene producttetratricopeptide repeat protein, putative
Gene product: Alternative name
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
top of page
  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationAn intermediate pBAT-derived vector was used (see RMgm-757)
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_0711900
Gene Model P. falciparum ortholog PF3D7_0818900
Gene productheat shock protein 70
Gene product: Alternative nameHSP70
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite PBANKA_1340000
Gene productdihydrofolate synthase/folylpolyglutamate synthase, putative
Gene product: Alternative nameDhfs-fpgs
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_1129800
Gene producttetratricopeptide repeat protein, putative
Gene product: Alternative name
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren