top of page |
Type and details of transgene |
Is the transgene Plasmodium derived |
Transgene: not Plasmodium |
Transgene name | mCherry |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct | Plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Selectable marker used to select the mutant parasite | tgdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | An HSP70/1 5' region of 2,220 bp was selected as promoter sequence and amplified from gDNA using primers HSP70_for (GCGAATTCAATGAGTGAATATGACTTTCATTCG) and HSP70_rev (GGGGATCCCATGTTTTTTTAATTGTAATTGTAATTTA TTGGG). The resulting fragment was cloned via EcoRI and BamHI restriction sites into a P. berghei targeting plasmid, termed pSE61 (kindly provided by Dr. Sabine Engelmann). Subsequently, mCherry was amplified from the plasmid B3D+mCherry [10] using primers mCherry_for-BamHI and mCherry_rev_SpeI and cloned via BamHI and SpeI downstream of the 5' promoter sequence. mCherry transcript stability was facilitated by cloning of the 3'UTR of P. berghei dihydrofolate reductase/thymidylate synthase (DHFR/TS) downstream of mCherry. The final plasmid, pHSP70/1::mCherry, was used for P. berghei transfection. |
Additional remarks selection procedure | |
top of page |
Other details transgene |
top of page |
Promoter |
Gene Model of Parasite |
PBANKA_0711900
|
Gene Model P. falciparum ortholog |
PF3D7_0818900
|
Gene product | heat shock protein 70 |
Gene product: Alternative name | HSP70; HSP70/1 |
Primer information details of the primers used for amplification of the promoter sequence
Primer information details of the primers used for amplification of the promoter sequence
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
top of page |
3'-UTR |
Gene Model of Parasite |
PBANKA_0719300
|
Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative |
Gene product: Alternative name | dhfr/ts |
Primer information details of the primers used for amplification the 3'-UTR sequences
Primer information details of the primers used for amplification the 3'-UTR sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
Insertion/Replacement locus |
Replacement / Insertion | Insertion locus |
Gene Model of Parasite |
PBANKA_0711900
|
Gene product | heat shock protein 70 |
Gene product: Alternative name | HSP70; HSP70/1 |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
|
|
top of page |