Back to search resultsSummaryRMgm-882
|
Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
The following genetic modifications were attempted | Gene disruption |
Number of attempts to introduce the genetic modification | 3 |
Reference (PubMed-PMID number) | Not published (yet) |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA 507cl1 (RMgm-7) |
Other information parent line | P.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190) |
top of page | |
Attempts to generate the mutant parasite were performed by | |
Name PI/Researcher | B. Franke-Fayard; J.B. Dame; C.J. Janse |
Name Group/Department | Leiden Malaria Research Group |
Name Institute | Leiden University Medical Center (LUMC) |
City | Leiden |
Country | The Netherlands |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1222500 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0808200 | ||||||||||||||||||||||||
Gene product | plasmepsin X | ||||||||||||||||||||||||
Gene product: Alternative name | |||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence |
ATGAAGAGCATAAAAATATTACCCGTATTTTATTTGGTGACATTTTTTTTGCACAACTAT
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Unknown | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | The negative attempts to disrupt plasmepsin X indicates an essential role during blood stage development. See also RMgm-84 for an independent, unsuccessful attempt to disrupt plasmepsin X P. berghei has 7 plasmepsins (aspartic proteases (PM IV-PM X). PM IV has a role in hemoglobin digestion (RMgm-314, RMgm-315, RMgm-316). P. falciparum PM V performs a critic role in the endoplasmic reticulum processing the PEXEL sequence of exported proteins. PM VI, VII, VII are not expressed in asexual blood stages; these are expressed in gametocytes/ookinetes/oocysts. PM VI plays an essential role in the formation of sporozoites within the oocyst (RMgm-97). | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |