RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-877
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1315300; Gene model (P.falciparum): PF3D7_1451600; Gene product: LCCL domain-containing protein (LAP5: FNPA)
Name tag: EGFP
Phenotype Fertilization and ookinete;
Last modified: 1 June 2013, 22:44
  *RMgm-877
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23684590
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherSaeed, S; Dessens, T
Name Group/DepartmentDepartment of Pathogen Molecular Biology, Faculty of Infectious and Tropical Diseases
Name InstituteLondon School of Hygiene & Tropical Medicine
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-877
Principal namePbLAP5/GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteGFP expression in ookinetes. Ookinetes exhibited GFP-based fluorescence that typically distributed to 2–3 regions visibly associated with clusters of malariapigment, characteristic of crystalloid targeting
OocystNot different from wild type
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a C-terminal GFP-tagged version of LAP5 (PNFA). The tagged gene is under the control of the lap5 promoter region and the pbdhfr 3'UTR.

Protein (function)
The lap5 (pnfa) gene is a member of a small conserved gene family (6 genes), encoding proteins with multiple adhesive domains, for example a Lgl1 (LCCL)-lectin adhesive domain. In P. falciparum the LCCL domain-containing proteins are termed PfCCp's and in P. berghei PbLAP's

Phenotype
GFP expression in ookinetes. Ookinetes exhibited GFP-based fluorescence that typically distributed to 2–3 regions visibly associated with clusters of malaria-pigment, characteristic of crystalloid targeting.
No GFP expression in gametocytes and mature oocysts. mRNA is present in mature gametocytes indicating translational repression in gametocytes.

Additional information
Evidence has been presented in different studies for protein expression of LAP1, LAP2, LAP3 in gametocytes and ookinetes whereas protein expression of LAP4, LAP5 and LAP6 is absent in gametocytes. All proteins are associated with crystalloid bodies in ookinetes. See also mutants with different lap genes deleted: all these gene deletion studies show a defect during oocyst/sporozoite development.

Other mutants


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1315300
Gene Model P. falciparum ortholog PF3D7_1451600
Gene productLCCL domain-containing protein
Gene product: Alternative nameLAP5: FNPA
Details of the genetic modification
Name of the tagEGFP
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe entire pblap5 coding sequence plus ca. 0.6 kb of upstream sequence was PCR amplified fromgenomic DNA with primers P5 (ACGAAGTTATCAGTCGAAGCTTCATACTGTTATATATTGCACATATAGCC) and P6 (ATGAGGGCCCCTAAGCTATTGTGGAGAAATATAATTTGTATAGATTG) and cloned into SalI/HindIII-digested pDNR-EGFP (RMgmDB-678) to give plasmid pDNR-PbLAP5/EGFP. The 3UTR of pblap5 was amplified with primers P7(CCTTCAATTTCGACATAGAGGCATTTGACAAACAAAC) and P8 (GCGGCCGCTCTAGCATAATGTTTTATTTTTTCCATTTTCAGC)and the resulting ca. 0.7 kb fragment cloned into NdeI-digested pLP-hDHFR by in-fusion cloning to give plasmid pLP-hDHFR/PbLAP5. The pblap5/egfp-specific sequence from pDNR-PbLAP5/EGFP was transferred to pLP-hDHFR/PbLAP5 by cre/loxp recombination to give the final construct pLP-PbLAP5/EGFP. Plasmid pLP-PbLAP5/EGFP was linearized with HindIII and SacII to remove the vector backbone prior to transfection.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6