RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-841
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1332400; Gene model (P.falciparum): PF3D7_1469200; Gene product: shewanella-like protein phosphatase 1, putative (SHLP1)
Name tag: GFP
Phenotype Asexual bloodstage; Gametocyte/Gamete; Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 13 March 2013, 15:53
  *RMgm-841
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23434509
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943)
The mutant parasite was generated by
Name PI/ResearcherPatzewitz EM; Tewari R
Name Group/DepartmentCentre for Genetics and Genomics, School of Biology, Queens Medical Centre
Name InstituteUniversity of Nottingham
CityNottingham
CountryUK
Name of the mutant parasite
RMgm numberRMgm-841
Principal nameSHLP1-GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageSHLP1-GFP expression in asexual blood stages
Gametocyte/GameteSHLP1-GFP expression in gametocytes (prominent expression in male gametes)
Fertilization and ookineteSHLP1-GFP expression in ookinetes
Oocyst(Prominent) SHLP1-GFP expression in oocysts
SporozoiteSHLP1-GFP expression in sporozoites
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant  expresses a C-terminal GFP-tagged version of shewanella-like protein phosphatase 1 (SHLP1).

Protein (function)
Bioinformatic analysis of the Plasmodium genome has revealed the presence of non-conventional protein phosphatases (PPs) containing kelch-like motifs as found in plant PPs and two bacterial Shewanella-like PPs (Shelphs or SHLP), both lacking orthologs in humans. SHLPs are related to the phosphoprotein phosphatase (PPP) family of serine/threonine PPs (STPs), span the eukaryote-prokaryote boundary, and are also present in plants, heterokonts, fungi, and some Protozoa.

Phenotype analyses of a mutant lacking expression of SHLP1 (RMgm-840)  indicate a role of this protein in ookinete formation.

Phenotype
Phenotype analyses of a mutant lacking expression of SHLP1 (RMgm-840)  indicate a role of this protein in ookinete formation.

Analysis of the mutant expressing the GFP-tagged version of SHLP1showed diffuse fluorescence staining in all parasite stages examined by microscopy with prominent staining in the asexual stages, the male gamete, and oocyst. Despite the presence of a predicted apicoplast targeting signal, the protein was found distributed non-uniformly throughout the parasite cytoplasm in all stages analyzed and co-localized with ER tracker Red, suggesting that SHLP1-GFP is located in the endoplasmic reticulum (ER).

Additional information

Other mutants
RMgm-840: A mutant lacking expression of SHLP1.


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1332400
Gene Model P. falciparum ortholog PF3D7_1469200
Gene productshewanella-like protein phosphatase 1, putative
Gene product: Alternative nameSHLP1
Details of the genetic modification
Name of the tagGFP
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodiesInvitrogen
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid EcoRV
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationFor GFP-tagging by single homologous recombination, a 703 bp region of shlp1 starting 383 bp downstream of the ATG start codon and omitting the stop codon was amplified using primers T0801 and T0802. This was inserted upstream of the gfp sequence in the pOB277 vector using KpnI and ApaI restriction sites. The pOB277 vector contains the human dhfr cassette, also conveying resistance to pyrimethamine. Before transfection, the sequence was linearized using EcoRV
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCCGGTACCTAGGGTAATATTAATAATGGGAAACCACG
Additional information primer 1T0801
Sequence Primer 2CCCCGGGCCCCAAAACTGGGTTCAAATTAGTTTGAC
Additional information primer 2T0802
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6