RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-786
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1329500; Gene model (P.falciparum): PF3D7_1466100; Gene product: protein phosphatase containing kelch-like domains (PPKL; PPalpha)
Name tag: GFP
Phenotype Asexual bloodstage; Gametocyte/Gamete; Fertilization and ookinete;
Last modified: 11 November 2012, 16:43
  *RMgm-786
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22957089
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherN. Philip; A.P. Waters
Name Group/DepartmentWellcome Trust Centre for Molecular Parasitology, Institute of Infection, Immunity and Inflammation
Name InstituteUniversity of Glasgow
CityGlasgow
CountryUK
Name of the mutant parasite
RMgm numberRMgm-786
Principal nameppkl-gfp
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageAnalyses of the mutant expressing GFP-tagged PPKLshows expression in schizonts, female gametocytes and ookinetes.
Gametocyte/GameteAnalyses of the mutant expressing GFP-tagged PPKLshows expression in schizonts, female gametocytes and ookinetes.
Only female gametocytes and not males expressed PPKL.
Fertilization and ookineteAnalyses of the mutant expressing GFP-tagged PPKL shows expression in schizonts, female gametocytes and ookinetes.
Only female gametocytes and not males expressed PPKL.
In ookinetes PPKL is localized predominantly in the cytoplasm with a particularly intense expression at the apical tip of the developing and mature ookinete.
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation

The mutant expresses a C-terminal GFP-tagged version of PPKL (protein phosphatase containing kelch-like domains).

Protein (function)
PPKL is a distinctive PP1-related enzyme belonging to the PPP family of phosphatases comprising an N-terminal kelch repeat domain and a C-terminal PP1-like phosphatase domain (named PPKL: Protein Phosphatase with Kelch-Like domains). It has been detected in the apicomplexans Cryptosporidium hominis, Toxoplasma gondii and Theileria parva (one gene per genome), as well as in the land plants Arabidopsis thaliana and Oryza sativa (4 and 5 genes respectively). The kelch motif is widespread and involved in many cellular functions, particularly in actin-based cytoskeleton formation and transcriptional regulation. PPKL has only been studied in detail in Arabidopsis thaliana (where it is known as BSU1 or bri1 suppressor1) and along with the kinase BIN2, is involved in brassinosteroid hormone signalling and phosphorylation of the transcription factors BZR1 and BES1

In contrast to the human phosphatome (comprising approximately 156 phosphatases the Plasmodium genome codes for one of the smallest phosphatomes of all the eukaryotic phyla known to date, with 27 putative protein phosphatases falling into four major classes: phosphoprotein phosphatases (PPPs), metallo-dependent protein phosphatases (PPMs), protein tyrosine phosphatases (PTPs) and NLI interacting factor-like phosphatases (NIFs).

Phenotype analyses of mutants lacking expression of PPKL (RMgm-686, RMgm-687) indicate an essential role of PPKL in maturation of ookinetes.
Deletion of the ppkl gene caused abnormal ookinete development, loss of ookinete motility and failure of ookinetes to invade the mosquito midgut epithelium. Evidence is presented for aberrant formation of the apical end and disorganization of microtubules.

Phenotype
Phenotype analyses of mutants lacking expression of PPKL (RMgm-686, RMgm-687) indicate an essential role of PPKL in maturation of ookinetes.

Analyses of the mutant expressing GFP-tagged PPKLshows expression in schizonts, female gametocytes and ookinetes. Immunofluorescence studies using anti-PPKL polyclonal antibody showed expression in merozoites, female gametocytes, zygotes, ookinete, and sporozoites. Only female gametocytes and not males expressed PPKL. PPKL is localized predominantly in the cytoplasm with a particularly intense expression at the apical tip of the developing and mature ookinete.

Additional information
 

Other mutants
RMgm-785: A mutant lacking expression of PPKL
RMgm-787: An independent mutant lacking expression of PPKL
RMgm-788: An independent mutant expressing an endogenous, GFP-tagged, version of PPKL


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1329500
Gene Model P. falciparum ortholog PF3D7_1466100
Gene productprotein phosphatase containing kelch-like domains
Gene product: Alternative namePPKL; PPalpha
Details of the genetic modification
Name of the tagGFP
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid BglII
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationC-terminal GFP tagged PPKL parasite lines were generated using the PL0031 vector using single crossover homologous
recombination containing 1 kb of the ppkl C-terminus amplified by using primers SacII-GU762 and BamHI-GU763
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TAGCTTCCGCGGCATGGTCAAATGTATCTATATTATGTTCTATGG
Additional information primer 1GU0762 (SacII); For-ppkl for GFP tagging
Sequence Primer 2TGGAGCCCCATAATTTAATTCTCTC
Additional information primer 2GU0763 (BamHI); Rev-ppkl for GFP tagging
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6