top of page |
Type and details of transgene |
Is the transgene Plasmodium derived |
Transgene: not Plasmodium |
Transgene name | drFP583/DsRed/RFP, RedStar |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct | Plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Selectable marker used to select the mutant parasite | pbdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | The RedStar open reading frame was amplified from the plasmid PRS415-Gal1-RedStar with primers RFPfor (5' CGGGATCCAAAATGAGTAGATCTTCTAAGAAC 3' and RFPrev (5'GGACTAGTTTACAAGAACAAGTGGTGTCTACC 3'). RedStar was chosen because of its 10–20x enhanced brightness compared to RFP when expressed in mammalian cells.
The RFP (RedStar) gene is under control of the 5'UTR of the cs gene and the 3'UTR of the dhfr-ts gene of P. berghei. The construct is stably integrated into the genome. No information available on the insertion locus. |
Additional remarks selection procedure | |
top of page |
Other details transgene |
top of page |
Promoter |
Gene Model of Parasite |
PBANKA_0403200
|
Gene Model P. falciparum ortholog |
PF3D7_0304600
|
Gene product | circumsporozoite (CS) protein |
Gene product: Alternative name | CSP |
Primer information details of the primers used for amplification of the promoter sequence
Primer information details of the primers used for amplification of the promoter sequence
Sequence Primer 1 | 5' CCGGAATTCACATAAAAGGGAATATGGAATATACTAGC 3' |
Additional information primer 1 | p5'CSEcoRIfor |
Sequence Primer 2 | 5' CGCGGATCCAAATATATGCGTGTATATATAGATTTTG 3' |
Additional information primer 2 | p5'CSBamHIrev |
|
|
top of page |
3'-UTR |
Gene Model of Parasite |
PBANKA_0719300
|
Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative |
Gene product: Alternative name | DHFR/TS |
Primer information details of the primers used for amplification the 3'-UTR sequences
Primer information details of the primers used for amplification the 3'-UTR sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
Insertion/Replacement locus |
Replacement / Insertion | Insertion locus |
Gene Model of Parasite |
Not available
|
Gene product | Not available |
Gene product: Alternative name | |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
|
|
top of page |