Summary

RMgm-501
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0401500; Gene model (P.falciparum): PF3D7_0302900; Gene product: exportin-1, putative
PhenotypeNo phenotype has been described
Last modified: 21 December 2011, 09:52
  *RMgm-501
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22184632
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 1037m1f1mocl1 (RMgm-32)
Other information parent lineP. berghei ANKA 1037m1f1mocl1 (1037cl1; RMgm-32) is a reference ANKA mutant line which expresses GFP-luciferase under control of a schizont-specific promoter (PubMed: PMID: 20019192). It does not contain a drug-selectable marker and has been selected by FACS sorting based on GFP expression
The mutant parasite was generated by
Name PI/ResearcherJ. Fonager, E.M. Pasini, C.J. Janse, B.M Franke-Fayard
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center (LUMC)
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-501
Principal nameexp. 1249
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

A pyrimethamine-resistant parasite population was selected after transfection with a construct for targeted gene disruption by double cross-over homologous recombination. The primers of the two target sequences of the gene are provided below.

The genotype of the parasites has not been analysed in detail.
Diagnostic PCR (for correct integration of the construct) and/or Southern analysis of PFG-separated chromosomes (to show integration into the chromosome on which the target gene is located) have been performed (see below). This analysis provided evidence for correct disruption of the gene indicating that it has no essential function during asexual blood stage development. However, no further analyses on the parasite population/cloned lines have been performed to show absence of transcripts or protein .

The phenotype of the selected parasite population/cloned lines has not been analysed in detail.
No obvious growth defects of the asexual blood stages of the selected parasite populations/cloned lines have been observed.

Small scale mosquito transmission experiments showed normal numbers of oocysts, sporozoites and sporozoite infectivity as measured by prepatent period in mice after injection of 10.000 sporozoites.

The gene has been selected for targeted gene disruption based on its presence in a proteome of membranes of infected red blood cells


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0401500
Gene Model P. falciparum ortholog PF3D7_0302900
Gene productexportin-1, putative
Gene product: Alternative name
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
AGCTTGGGCCCCCGCGGTGGCGGCCGCTCTAGCTTTGATCCCGTTTTTCTTACTTATATA
TTTATACCAATTGATTGTATTTATAACTGTAAAAATGTGTATGTTGTGTGCATATTTTTT
TTTGTGCATGCACATGCATGTAAATAGCTAAAATTATGAACATTTTATTTTTTGTTCAGA
AAAAAAAAACTTTACACACATAAAATGGCTAGTATGAATAGCCATATTTTATATAAATTA
AATCCTATGAATTTATGACCATATTAAAAATTTAGATATTTATGGAACATAATATGTTTG
AAACAATAAGACAAAATTATTATTATTATTATTATTTTTACTGTTATAATTATGTTGTCT
CTTCAATGATTCATAAATAGTTGGACTTGATTTTTAAAATGTTTATAATATGATTAGCAT
AGTTAAATAAAAAAAGTTGAAAAATTAAAAAAAAACATATAAACACAAATGATGTTTTTT
CCTTCAATTTCGATTGATAATTCCTGCAGCCCAGCTTAATTCTTTTCGAGCTCTTTATGC
TTAAGTTTACAATTTAATATTCATACTTTAAGTATTTTTTGTAGTATCCTAGATATTGTG
CTTTAAATGCTCACCCCTCAAAGCACCAGTAATATTTTCATCCACTGAAATACCATTAAA
TTTTCAAAAAAATACTATGCATATAATGTTATACATATAAACATAAAACGCCATGTAAAT
CAAAAAATATATAAAAATATGTATAAAAATAAATATGCACTAAATATAAGCTAATTATGC
ATAAAAATTAAAGTGCCCTTTATTAACTAGAACTAGTCGTAATTATTTATATTTCTATGT
TATAAAAAAATCCTCATATAATAATATAATTAATATATGTAATGTTTTTTTTATTTTATA
ATTTTAATATAAAATAATATGTAAATTAATTCAAAAAATAAATATAATTGTTGTGAAACA
AAAAACGTAATTTTTTCATTTGCCTTCAAAATTTAAATTTATTTTAATATTTCCTAAAAT
ATATATACTTTGTGTATAAATATATAAAAATATATATTTGCTTATAAATAAATAAAAAAT
TTTATAAAACATAGGGGGATCCATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCA
GAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAACGAATTTAG
ATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTAT
GGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAA
TTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAG
TCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGT
CTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAA
ACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGA
TTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGA
GAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATGCTAGCGGAGGAGGTGG
ATCTGGTGGAGGTGGAAGTGCTAGCGTGACAGGGGGAATGGCAAGCAAGTGGGATCAGAA
GGGTATGGACATTGCCTATGAGGAGGCGGCCTTAGGTTACAAAGAGGGTGGTGTTCCTAT
TGGCGGATGTCTTATCAATAACAAAGACGGAAGTGTTCTCGGTCGTGGTCACAACATGAG
ATTTCAAAAGGGATCCGCCACACTACATGGTGAGATCTCCACTTTGGAAAACTGTGGGAG
ATTAGAGGGCAAAGTGTACAAAGATACCACTTTGTATACGACGCTGTCTCCATGCGACAT
GTGTACAGGTGCCATCATCATGTATGGTATTCCACGCTGTGTTGTCGGTGAGAACGTTAA
TTTCAAAAGTAAGGGCGAGAAATATTTACAAACTAGAGGTCACGAGGTTGTTGTTGTTGA
CGATGAGAGGTGTAAAAAGATCATGAAACAATTTATCGATGAAAGACCTCAGGATTGGTT
TGAAGATATTGGTGAGGCTTCGGAACCATTTAAGAACGTCTACTTGCTACCTCAAACAAA
CCAATTGCTGGGTTTGTACACCATCATCAGAAATAAGAATACAACTAGACCTGATTTCAT
TTTCTACTCCGATAGAATCATCAGATTGTTGGTTGAAGAAGGTTTGAACCATCTACCTGT
GCAAAAGCAAATTGTGGAAACTGACACCAACGAAAACTTCGAAGGTGTCTCATTCATGGG
TAAAATCTGTGGTGTTTCCATTGTCAGAGCTGGTGAATCGATGGAGCAAGGATTAAGAGA
CTGTTGTAGGTCTGTGCGTATCGGTAAAATTTTAATTCAAAGGGACGAGGAGACTGCTTT
ACCAAAGTTATTCTACGAAAAATTACCAGAGGATATATCTGAAAGGTATGTCTTCCTATT
AGACCCAATGCTGGCCACCGGTGGTAGTGCTATCATGGCTACAGAAGTCTTGATTAAGAG
AGGTGTTAAGCCAGAGAGAATTTACTTCTTAAACCTAATCTGTAGTAAGGAAGGGATTGA
AAAATACCATGCCGCCTTCCCAGAGGTCAGAATTGTTACTGGTGCCCTCGACAGAGGTCT
AGATGAAAACAAGTATCTAGTTCCAGGGTTGGGTGACTTTGGTGACAGATACTACTGTGT
TTAACTCGATCCCGTTTTTCTTACTTATATATTTATACCAATTGATTGTATTTATAACTG
TAAAAATGTGTATGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCATGTAAATAGCT
AAAATTATGAACATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACACATAAAATGGC
TAGTATGAATAGCCATATTTTATATAAATTAAATCCTATGAATTTATGACCATATTAAAA
ATTTAGATATTTATGGAACATAATATGTTTGAAACAATAAGACAAAATTATTATTATTAT
TATTATTTTTACTGTTATAATTATGTTGTCTCTTCAATGATTCATAAATAGTTGGACTTG
ATTTTTAAAATGTTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTGAAAAATTAAA
AAAAAACATATAAACACAAATGATGTTTTTTCCTTCAATTTCGGGTACGTACCCTCGAGC
CTTCCACCTTCAGATCCTTTGTACGCGATTTGCTAATATCGTTGAAGGTTGGGTGATTAA
ATGGAATTTCATTTATCATGTTGCACATTTAGTTGATAATCCCTTTCGTGTTCGTTTCAT
TCCCCCTTCTCATTTTTATTCCATTTTGTTTTTTATCAGGAATTTTCTACAAACCAAGAC
GAACTGTATGAAGCTGACAGACAAGAGGCTTTACAGAGGGCAAAAATGGCAGAGGACAAC
AAACTGATAAAGGTATTCAAAAGATACACTTCACATTTATGCTAAGCGAATATAACATAT
ATATATTTTATTTTTGGCTAGCTCATTTCGCATTTATATAGTATCACCCTCCAATATGTA
TATATAAGAGTCACAAATGTATTTTTTTTTTTTTTTTTTTTTTTAAATTAGTTGAGAGGA
TTAATGAAAGAAGACGTACCGTCATTTTCGGCCATTGATGTTGATGATGAATGTATAAAT
GTAGAATGAACATAATTATACTTAAAAAGTTTTTTCATCATGATTTTGTTATTATTGCCT
TGTGCGTCATAATATATATATTTTTCATACTTTTTCATATTTTTTTCATTATTATATATA
CTATTTTTTAAAAATTATTTTGGTTAATTTTTTAAAATTTATATTAATACAATTTTTTTT
AATATATACATTTTATTTATTTTTTTAAAAGTCTTATATGATTAAAATGGTAAACATATA
TGCATATGCGTGTAATGGTGAAACATACACATATTAGTGAGGGATATCGAATTCCTGCAG
CCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAATTCGCCCTA
TAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCC
TGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAG
CGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGA
CGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGC
TACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCAC
GTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAG
TGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCC
ATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGG
ACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATA
AGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAA
CGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTG
CGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGA
CAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACAT
TTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCA
GAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATC
GAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCA
ATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGG
CAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCA
GTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATA
ACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAG
CTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCG
GAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCA
ACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTA
ATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCT
GGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCA
GCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAG
GCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCAT
TGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTT
TAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAA
CGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGA
GATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCG
GTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGC
AGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAG
AACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCC
AGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCG
CAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTAC
ACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGA
AAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTT
CCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAG
CGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCG
GCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTA
TCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGC
AGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGC
AAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCC
GACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCA
CCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAA
CAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTCGAAATTAACCCTCAC
TAAAGGGAACAAAAGCTGGTACCGTTATCAAATAGTAATATGGATGAAGTTTTTTTAATA
ATAGTTGATTATTATAATATTTTTACTGAACAGTTAATAAGAGAGTTAATAGGAAAATTA
GAAGAAGAAAATAGTATAAAAAACAAATGTGTGAATTCAAATAATAATATGCAAACAGAT
TTAAAAAATGGTATGAATAATAATTTAGGATTTAATATAGGATTAGAAACAGGTGTTTTA
AATAATCGAAAGGTTTATAGTTTTGCTACAATGCACAATATAGGAATTGGAAATAGCAAT
GTGGGTAATGAAAATAGTATTATAAATATAAATGAATATTCATCTATTTTAGATAAAATA
GATTTGACACAATCTGATATTAAAAAAATATGTCCAAGAATAAAATTATATGAATTTATA
TTAAATGATATTCGAAGGACTATTATTGAAAAGATGGCTAAACCACAAGAAATATACATT
TCCTATGATAATGAAACGGGAGAAGTAGTAAGGGATTTTGAACCTGACACAACTGAAATA
TCTTTATATAACACAATGAAAACGACATTGGTATATTTAACTTATTTAGGATCTGAAAAA
ACAATAGAATTAATTGTAGAACTTTTAAATAAAGAATCTGA
Restriction sites to linearize plasmid Asp718I/EcoRV
Partial or complete disruption of the geneUnknown
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GCCGGTACCGTTATCAAATAGTAATATGGATG
Additional information primer 1F1 primer
Sequence Primer 2GCCAAGCTTCAGATTCTTTATTTAAAAGTTC
Additional information primer 2R1 primer
Sequence Primer 3GCCCTCGAGCCTTCCACCTTCAGATCCTTTG
Additional information primer 3F2 primer
Sequence Primer 4GCCGATATCCCTCACTAATATGTGTATGTTTC
Additional information primer 4R2 primer
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6