RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-1595
Malaria parasiteP. yoelii
Genotype
DisruptedGene model (rodent): PY17X_1024500; Gene model (P.falciparum): PF3D7_1420600; Gene product: pantothenate kinase 1, putative (PANK1)
Transgene
Transgene not Plasmodium: eGFP
Promoter: Gene model: PYYM_0712000; Gene model (P.falciparum): Not available; Gene product: heat shock protein, putative (HSP70)
3'UTR: Gene model: Not available; Gene product: Not available
Replacement locus: Gene model: PY17X_1024500; Gene product: pantothenate kinase 1, putative (PANK1)
Phenotype Asexual bloodstage; Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 26 September 2016, 10:05
  *RMgm-1595
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 27644319
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherHart RJ; Aly AS
Name Group/DepartmentDepartment of TropicalMedicine
Name InstituteTulane University
CityNewOrleans
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-1595
Principal namePypank1(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageSlight reduction of growth/multiplication of asexual blood stages.
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNo ookinete formation in vivo
OocystNo ookinete formation in vivo. No oocyst and sporozoite production.
SporozoiteNo ookinete formation in vivo. No oocyst and sporozoite production.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of pantothenate kinase 1, putative (PANK1) and expresses GFP under the control of the strong and constitutive hsp70 promoter.

Protein (function)
The water-soluble Vitamin B5 (pantothenic acid) plays a critical role in cellular metabolism of living organisms by serving as the main precursor for the synthesis of coenzyme A (CoA). CoA is an essential cofactor for a large number of metabolic processes including fatty acid biosynthesis, cellular oxidation, and carbohydrate and amino acid metabolism. Studies in P. falciparum have shown that the parasite cannot synthesize pantothenic acid de novo and relies on the uptake of exogenous pantothenate for survival. Once transported inside the parasite, pantothenic acid is rapidly phosphorylated to form phosphopantothenate (PP) by parasite encoded pantothenate kinases. This reaction has been shown to be the rate-limiting step in CoA biosynthesis in many organisms. Phosphopantothenate is subsequently converted into CoA by four enzymes PPCS (Phosphopantothenylcysteine Synthase), PPCDC (Phosphopantothenylcysteine Decarboxylase), PPAT (Phosphopantetheine Adenylyltransferase) and DPCK (Dephospho-CoA Kinase).
Sudies in P. falciparum have indicated that pantothenic acid uptake and utilization are absolutely crucial for asexual blood stage development of the parasite within human erythrocytes. Consistent with these data, pantothenate analogs inhibit intraerythrocytic development of P. falciparum.
Other malaria parasites have been shown to use alternative routes for the synthesis or acquisition of CoA. Earlier studies in P. lophurae have shown that this avian parasite can scavenge host CoA for survival in ducks erythrocytes. Similarly, genetic studies in the murine malaria parasite P. yoelii (see RMgm-1098) have shown that parasites lacking a candidate pantothenic acid transporter undergo normal asexual development in mouse erythrocytes, suggesting the presence of an alternative route for CoA biosynthesis in this parasite or an alternative pantothenate secondary transporter.

Phenotype
Slight reduction of growth/multiplication of asexual blood stages. No ookinete formation in vivo. No oocyst and sporozoite production.

Additional information

Other mutants
RMgm-1098: a mutant lacking expression of  pantothenate transporter (PAT)
RMgm-1596: a mutant lacking expression of pantothenate kinase 2, putative (PANK2)


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PY17X_1024500
Gene Model P. falciparum ortholog PF3D7_1420600
Gene productpantothenate kinase 1, putative
Gene product: Alternative namePANK1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGCCGCGGTCATGTAATGTTATAGTGTCATGCAACTAAAAAT
Additional information primer 131
Sequence Primer 2TCCGGATCCCGCTTACCTGTTTTGGGTATAGGAATCGGCATTCAT
Additional information primer 232
Sequence Primer 3TGCCAAGCTTTCAAAATAGGATAATAATAGATACTTTTAGAAT
Additional information primer 333
Sequence Primer 4TCCGGTACCTATATAGATATACATATTACTAAAAATGCAGTC
Additional information primer 434
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameeGFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PYYM_0712000
Gene Model P. falciparum ortholog Not available
Gene productheat shock protein, putative
Gene product: Alternative nameHSP70
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative name
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PY17X_1024500
Gene productpantothenate kinase 1, putative
Gene product: Alternative namePANK1
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4