RMgmDB - Rodent Malaria genetically modified Parasites
Back to search resultsSummaryRMgm-1415
|
||||||||||
Last modified: 29 February 2016, 18:51
*RMgm-1415| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | Unknown |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 26915471 |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 2.34 |
| Other information parent line | P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943) |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | Alves E; Tewari R; Garcia CR |
| Name Group/Department | Núcleo de Pesquisa em Sinalização Celular Patógeno-Hospedeiro (NUSCEP) |
| Name Institute | Departamento de Fisiologia, Instituto de Biociências, Universidade de São Paulo |
| City | São Paulo |
| Country | Brazil |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1210300 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1011900 | ||||||||||||||||||||||||
| Gene product | heme oxygenase | ||||||||||||||||||||||||
| Gene product: Alternative name | HO; heam oxygenase | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | The unsuccessful attempt(s) to disrupt this gene indicates an essential role for asexual blood stage growth/multiplication. Attempt(s) to c-terminal tag the gene with GFP were also unsuccessful (see RMgm-1416) Most mammalian cells use a different strategy to nullify haem toxicity by converting it to biliverdin (BV), a step catalysed by haem oxygenase (HO). The malaria parasite converts haem into the chemically inert haemozoin to avoid toxicity. The knockout construct was generated by inserting the pbHO 5′ untranslated region (UTR) region upstream (as Apa1 + HindIII fragment) and the pbHO 3′ UTR region (as EcoRI + Xba1 fragment) downstream of the dhfr cassette. Primers CCCCGGGCCCGGGCGATATGGAATGCACATTTTCTCCTC, N0501 and GGGGAAGCTTGCAATCATTTATTCTTTGTAATTG, N0502 were used to generate a 585 bp fragment of the 5′ upstream sequence of Pbho from genomic DNA, which was inserted into the ApaI and HindIII restriction sites upstream of the dhfr/ts cassette of pBS-DHFR. Primers CCCCGAATTCGAGCCGTAAATGGACACGATGGG (N0503) and GGGGTCTAGAGTCATTTTAAGGTTGGCATTATATTAGC (N0504) were used to generate a 418 bp fragment from the 3′ flanking region of Pbho, which was subsequently inserted downstream of the dhfr/ts cassette using EcoRI and XbaI restriction sites. The final knockout construct was digested with ApaI and XbaI to release the linearized fragment for ransfection. | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
 Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||