RMgmDB - Rodent Malaria genetically modified Parasites
Back to search resultsSummaryRMgm-1361
|
||||||||||
Last modified: 5 April 2016, 10:24
*RMgm-1361| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | 2 |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 26318454 |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | Not applicable |
| Other information parent line | |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | Mailu BM; Gradner MJ |
| Name Group/Department | Center for Infectious Disease Research |
| Name Institute | Center for Infectious Disease Research |
| City | Seattle |
| Country | US |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0718100 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0416100 | ||||||||||||||||||||||||
| Gene product | glutamyl-tRNA(Gln) amidotransferase subunit A | ||||||||||||||||||||||||
| Gene product: Alternative name | GaTA | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | The unsuccessful attempts to delete the gata gene indicates an essential role during blood stage growth/multiplication. See RMgm-1362 for a mutant expressing a Cmyc-tagged version of GaTA The strategy described previously (42) was used to attempt deletion of the PbGatA gene via double-crossover recombination. The primers used to amplify the genomic regions were as follows: PbGatA_KO.Pr1For (GCCCGCGGGCATGAGTTGTTAAAAGTTGCC) and PbGatA_KO.Pr2Rev (AGTTCTACTGGGCCCAAATTTAAGCATACAGAAAGTGAC); PbGatA_KO.Pr3For (CTTAAATTTGGGCCCAGTAGAACTAGAACATGAGGG) and PbGluRS_KO.Pr4Rev (GCCCGCGGTTTGTCCTTACAACTTTCTTACC). Primers 1 and 2 were designed to amplify a 942-bp fragment containing the last 102 bp of the PbGatA coding sequence and 840 bp of the 3′-UTR. Primers 3 and 4 were designed to amplify a 734-nucleotide fragment containing the first 62 bp of the PbGluRS coding sequence and 672 bp of the 5′-UTR. Primer 1 contained an added 5′-terminal GC dinucleotide and a SacII site. Primer 4 contained an added 5′-terminal GC dinucleotide and a SacII site. Primers 2 and 3 contained an ApaI site flanked by complementary sequences (underlined) for recombinatorial PCR. The two genomic fragments were first amplified in separate reactions using the cycling parameters described above, and the resulting products were combined in a second PCR to form a single product, which was digested with SacII cloned into the B3D KO Red vector. This construct was linearized with ApaI, and P. berghei ANKA parasites were transfected as described (43). The transfection experiments were performed in duplicate and repeated once. The malaria parasite Plasmodium falciparum apicoplast indirect aminoacylation pathway utilizes a non-discriminating glutamyl-tRNA synthetase to synthesize Glu-tRNAGln and a glutaminyl-tRNA amidotransferase to convert Glu-tRNAGln to Gln-tRNAGln. Plasmodium falciparum and other apicomplexans possess a unique heterodimeric glutamyl-tRNA amidotransferase consisting of GatA and GatB subunits (GatAB). The P. falciparum GatA and GatB subunits were loclized to the apicoplast in blood stage parasites | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
 Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||