Back to search resultsSummaryRMgm-1344
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene mutation, Introduction of a transgene |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 26271010 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | RMgm-1339 |
Other information parent line | A P.berghei ANKA transgenic reporter line expressing mCherry under control of the (sporozoite and liver-specific) UIS4 promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | Hopp CS; Sinnis P |
Name Group/Department | Department of Molecular Microbiology and Immunology |
Name Institute | Johns Hopkins Bloomberg School of Public Health |
City | Baltimore |
Country | USA |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-1344 |
Principal name | TRAP-VAL |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Not different from wild type |
Oocyst | Not different from wild type |
Sporozoite | Normal numbers of oocysts and midgut-derived sporozoites are produced. Strongly reduced (5x) numbers of salivary gland sporozoites. Motility of sporozoites is impaired. Sporozoites show a reduced capacity to invade hepatocytes in vitro. |
Liver stage | Strongly reduced (5x) numbers of salivary gland sporozoites. Motility of sporozoites is impaired. Sporozoites show a reduced capacity to invade hepatocytes in vitro. Sporozoites show reduced (10-100x) infectivity to mice. |
Additional remarks phenotype | Mutant/mutation |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1349800 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1335900 | ||||||||||||||||||||||||||
Gene product | thrombospondin-related anonymous protein | sporozoite surface protein 2 | ||||||||||||||||||||||||||
Gene product: Alternative name | TRAP; SSP2 | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Short description of the mutation | canonical rhomboid motif AGGIIGG changed to VALIIGV | ||||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||||
Short description of the conditional mutagenesis | Not available | ||||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||||||||||
Restriction sites to linearize plasmid | EcoRV, XhoI | ||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | Transfection plasmids designed to replace the endogenous locus with mutant or wild type TRAP were generated using pDEF-hDHFR containing the human dihydrofolate reductase (hDHFR) selection cassette. A 576 bp fragment of 5’UTR located 1000 bp upstream of TRAP was amplified by PCR using template genomic DNA from P.berghei ANKA parasites, with the primer pair, PbTRAP5’UTR-FWD (5’CAGCTAAGCTTGATATCCAAAAGTACAACATAAAAGGAACTGAATG-3’) and PbTRAP5’UTR-REV (5’- CAGCTAAGCTTCTCTTTTTTACATGTATTCAATTAGCATGC -3’) and this was cloned into pDEF-hDHFR upstream of the selection cassette. A second fragment, consisting of 1062 bp of 5’UTR directly upstream of the TRAP gene, 1821 bp of TRAP open reading frame, and 2057 bp of TRAP 3’UTR was amplified by PCR using the primer pairs PbTRAPFWD (5’CTGGTACCGAGAAATTCCTTCGTTTTATAATTTATAAAGC- 3’) and PbTRAPREV (5’CCGGTACCCTCGAGCAGAGCCAGGATATGAACTATTTTAAAAC-3’). This was cloned into pDEF-hDHFR downstream of the selection cassette to generate the plasmid pTRAP, which was then used to generate the TRAP mutants using the Quick Change Mutagenesis kit (Stratagene). Generation of the TRAP-VAL cleavage site mutant required 2 steps. Primers MUT-TRAPVAL1FWD and MUT-TRAP VAL1REV were used to generate pTRAP-VALIIGG and then this plasmid was mutated to VALIIGV using primers, MUT-TRAP-VALGV-2FWD and MUT-TRAP-VALGV-2REV. The construct was sequenced to confirm the presence of the desired mutation and digested with EcoRV and XhoI to liberate the fragment used for transfection | ||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |
top of page | |||||||||||||||||||
Type and details of transgene | |||||||||||||||||||
Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
Transgene name | mCherry | ||||||||||||||||||
top of page | |||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||
Inducable system used | No | ||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||
Type of plasmid/construct | (Linear) PCR construct double cross-over | ||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||
Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||
Promoter of the selectable marker | eef1a | ||||||||||||||||||
Selection (positive) procedure | No | ||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||
Additional remarks genetic modification | |||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||
top of page | |||||||||||||||||||
Other details transgene | |||||||||||||||||||
top of page | |||||||||||||||||||
Promoter | |||||||||||||||||||
Gene Model of Parasite | PBANKA_0501200 | ||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1016900 | ||||||||||||||||||
Gene product | early transcribed membrane protein 10.3 | protein of early gametocyte 4 | ||||||||||||||||||
Gene product: Alternative name | UIS4, up-regulated in infective sporozoites; ETRAMP10.3 | ||||||||||||||||||
| |||||||||||||||||||
top of page | |||||||||||||||||||
3'-UTR | |||||||||||||||||||
Gene Model of Parasite | PBANKA_0501200 | ||||||||||||||||||
Gene product | early transcribed membrane protein up-regulated in infective sporozoites | ||||||||||||||||||
Gene product: Alternative name | UIS4, up-regulated in infective sporozoites; ETRAMP10.3 | ||||||||||||||||||
| |||||||||||||||||||
Insertion/Replacement locus | |||||||||||||||||||
Replacement / Insertion | Replacement locus | ||||||||||||||||||
Gene Model of Parasite | PBANKA_0306000 | ||||||||||||||||||
Gene product | 6-cysteine protein | ||||||||||||||||||
Gene product: Alternative name | 230p | ||||||||||||||||||
| |||||||||||||||||||
top of page |