Back to search resultsSummaryRMgm-1249
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene mutation, Gene tagging |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25900212 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA 2.34 |
Other information parent line | P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | S. Saeed; V. Carter; J.T. Dessens |
Name Group/Department | Department of Infectious and Tropical Diseases |
Name Institute | London School of Hygiene & Tropical Medicine |
City | London |
Country | UK |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-1249 |
Principal name | PbLAP3/LCCL-KO |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not tested |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Cultured ookinetes examined by confocal microscopy 24 h post-gametogenesis displayed no apparent differences between PbLAP3/LCCL-KO and PbLAP3/GFP control parasite lines, the majority of ookinetes displaying two fluorescent spots characteristic of the crystalloids. In contrast, when PbLAP3/LCCL-KO ookinetes were examined at 18 h post-gametogenesis they looked markedly different from PbLAP3/GFP control ookinetes, possessing notably more and generally smaller fluorescent spots. TEM examination of these ookinetes revealed the presence of more and much smaller clusters of subunit vesicles. |
Oocyst | Not different from wild type |
Sporozoite | Not different from wild type |
Liver stage | Not different from wild type |
Additional remarks phenotype | Mutant/mutation In a mutant lacking expression of LAP3 (1250) crystalloid bodies are absent. This mutants shows a severe defect in formation of sporozoites. Additional information Phenotype analyses of mutants lacking expression of different members of the LCCL domain-containing protein family (for example see LAP1/CCp3 RMgm-113, RMgm-114; LAP2/CCp1 RMgm-118, RMgm-121; LAP4/CCp2 RMgm-119; LAP6; CCp4 RMgm-120) indicate a role of several these proteins during oocyst development and sporozoite formation/production. |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0204500 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0109100 | ||||||||||||||||||||||||||
Gene product | LCCL domain-containing protein | ||||||||||||||||||||||||||
Gene product: Alternative name | LAP3; LCCL/lectin adhesive-like protein 2; CCp5 | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Short description of the mutation | The LCCL domain (amino acids 708–846) of PbLAP3 removed | ||||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||||
Short description of the conditional mutagenesis | Not available | ||||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | Plasmid pLP-PbLAP3/EFGP (RMgm-356) served as a template for inverse PCR using primers LAP3-LCCLKO-F (5'ACCATCATCCTTTATATTACTCAATACCAAATAGCTATTCA3') and LAP3-LCCLKO-R2 (5'TATAAAGGATGATGGTTCATATATTCATTATCTATTATATTACATGA30) to generate the transfection construct pLP-PbLAP3/LCCL-KO, in which the entire LCCL domain, corresponding to amino acids 708–846 of PbLAP3, has been removed from the PbLAP3 coding sequence. The plasmid were linearised with HindIII and SacII restriction enzymes to remove the vector backbone. | ||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0204500 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0109100 | ||||||||||||||||||||||||||
Gene product | LCCL domain-containing protein | ||||||||||||||||||||||||||
Gene product: Alternative name | LAP3; LCCL/lectin adhesive-like protein 2; CCp5 | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Name of the tag | EGFP | ||||||||||||||||||||||||||
Details of tagging | C-terminal | ||||||||||||||||||||||||||
Additional remarks: tagging | |||||||||||||||||||||||||||
Commercial source of tag-antibodies | |||||||||||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | Plasmid pLP-PbLAP3/EFGP (RMgm-356) served as a template for inverse PCR using primers LAP3-LCCLKO-F (5'ACCATCATCCTTTATATTACTCAATACCAAATAGCTATTCA3') and LAP3-LCCLKO-R2 (5'TATAAAGGATGATGGTTCATATATTCATTATCTATTATATTACATGA30) to generate the transfection construct pLP-PbLAP3/LCCL-KO, in which the entire LCCL domain, corresponding to amino acids 708–846 of PbLAP3, has been removed from the PbLAP3 coding sequence. The plasmid were linearised with HindIII and SacII restriction enzymes to remove the vector backbone. | ||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |