Back to search resultsSummaryRMgm-1160
|
Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
The following genetic modifications were attempted | Gene disruption |
Number of attempts to introduce the genetic modification | 4 |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 26991313 |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA 676m1cl1 (RMgm-29) |
Other information parent line | 676m1cl1 (RMgm-29) is a reference ANKA mutant line which expresses GFP-luciferase under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190). |
top of page | |
Attempts to generate the mutant parasite were performed by | |
Name PI/Researcher | Rijpma SR, Janse CJ, Franke-Fayard BM |
Name Group/Department | Leiden Malaria Research Group |
Name Institute | Leiden University Medical Center (LUMC) |
City | Leiden |
Country | The Netherlands |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1364800 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1352100 | ||||||||||||||||||||||||
Gene product | ABC transporter B family member 6, putative | ||||||||||||||||||||||||
Gene product: Alternative name | MDR6 (multidrug resistance protein 6); ABCB6 | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence |
AGCTTGCATGCCTGCAGGTCAACAATAAATAATAAATAAATATTGTGGAAATAAAATAAC
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | Four unsuccessful transfection experiments using DNA construct pL1923 (exp. 2128, 2144, 2145, 2160). The unsuccessful attempts to delete the gene indicate an essential role during blood stage growth/multiplication. In different Plasmodium parasites 14-16 ABC-transporter genes have been identified (16 in P. falciparum, 14 in P. berghei). Based on phylogenetic analysis of the conserved nucleotide-binding domains, seven of these are recognized as members of the B family of ABC transporters (both in P. falciparum and in P. berghei). This includes MDR6 (multidrug resistance protein 6). | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |