Back to search resultsSummaryRMgm-1141
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene disruption, Gene disruption |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25407681 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | RMgm-934 |
Other information parent line | In mutant RMgm-934 (PbΔb9Δsm) the b9 gene is removed and it does not contain a drug-selectable marker (the hdhfr-yfcu marker has been removed by negative selection). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | Schaijk B van; Janse CJ; Khan SM; Sauerwein RW |
Name Group/Department | Leiden Malaria Research Group |
Name Institute | Leiden University Medical Center (LUMC) |
City | Leiden |
Country | The Netherlands |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-1141 |
Principal name | 1844cl1 |
Alternative name | PbΔb9Δslarp |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Not different from wild type |
Oocyst | Not different from wild type |
Sporozoite | Not different from wild type |
Liver stage | Normal numbers of motile sporozoites are formed. Sporozoites show normal traversal and invasion of hepatocytes in vitro. Development of liver stages is completely aborted soon after invasion of sporozoites. Intravenous injection of up to 500.000 PbΔb9Δslarp sporozoites never led to full development of parasites in the liver as assayed by in vivo imaging of parasite liver loads or analysis of blood stage infection. |
Additional remarks phenotype | Mutant/mutation Other mutants |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0808100 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0317100 | ||||||||||||||||||||||||
Gene product | 6-cysteine protein | ||||||||||||||||||||||||
Gene product: Alternative name | B9 | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence |
AGCTTGGGCCCCCGCGGTGGCGGCCGCTCTAGCTTTGATCCCGTTTTTCTTACTTATATA
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||||||||
Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||
Selection (positive) procedure | No | ||||||||||||||||||||||||
Selection (negative) procedure | 5-fluorocytosine (5-FC) | ||||||||||||||||||||||||
Additional remarks genetic modification | The slarp gene has been disrupted in mutant RMgm-934. In mutant RMgm-934 (PbΔb9Δsm) the b9 gene is removed and it does not contain a drug-selectable marker (the hdhfr-yfcu marker has been removed by negative selection). The slarp gene was disrupted using a linear construct that was generated using a 2-step, anchor tagging PCR method (for primer details see below). The 5’- and 3’ targeting regions of the gene were PCR amplified from genomic DNA using primer pairs 1&2 and 3&4. Primers 2 and 3 have 5’-terminal extensions homologues to the hDHFR selectable marker cassette. Primers 1 and 4 both have a 5’-terminal overhang with an anchor-tag which serves as a primer site in the 2nd PCR reaction. The target fragments from the first PCR reaction were annealed to either side of the selectable marker cassette by PCR with anchor-tag primers 5 and 6, resulting in the 2nd PCR product. The hDHFR selectable marker cassette used in this reaction was digested from pL0040 using restriction enzymes XhoI and NotI. pL0040 is available from The Leiden Malaria Research Group. To remove the anchor-tags from the final KO construct, and to eliminate contaminating pL0040, the 2nd PCR product was digested with Asp718/ScaI and DpnI respectively. DpnI only cuts methylated plasmid DNA but not the PCR product. Using this PCR-based targeting construct (pL1740) the mutant PbΔb9Δslarp (1844cl1) was generated in mutant RMgm-934 | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0902100 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1147000 | ||||||||||||||||||||||||
Gene product | sporozoite and liver stage asparagine-rich protein | sporozoite asparagine-rich protein | ||||||||||||||||||||||||
Gene product: Alternative name | |||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence |
GAACTCGTACTCCTTGGTGACGGGTACCGGGAGTCAAAAACGGTATGCAAAGCTAAATAA
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||||||||
Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||
Selection (positive) procedure | No | ||||||||||||||||||||||||
Selection (negative) procedure | 5-fluorocytosine (5-FC) | ||||||||||||||||||||||||
Additional remarks genetic modification | The slarp gene has been disrupted in mutant RMgm-934. In mutant RMgm-934 (PbΔb9Δsm) the b9 gene is removed and it does not contain a drug-selectable marker (the hdhfr-yfcu marker has been removed by negative selection). The slarp gene was disrupted using a linear construct that was generated using a 2-step, anchor tagging PCR method (for primer details see below). The 5’- and 3’ targeting regions of the gene were PCR amplified from genomic DNA using primer pairs 1&2 and 3&4. Primers 2 and 3 have 5’-terminal extensions homologues to the hDHFR selectable marker cassette. Primers 1 and 4 both have a 5’-terminal overhang with an anchor-tag which serves as a primer site in the 2nd PCR reaction. The target fragments from the first PCR reaction were annealed to either side of the selectable marker cassette by PCR with anchor-tag primers 5 and 6, resulting in the 2nd PCR product. The hDHFR selectable marker cassette used in this reaction was digested from pL0040 using restriction enzymes XhoI and NotI. pL0040 is available from The Leiden Malaria Research Group. To remove the anchor-tags from the final KO construct, and to eliminate contaminating pL0040, the 2nd PCR product was digested with Asp718/ScaI and DpnI respectively. DpnI only cuts methylated plasmid DNA but not the PCR product. Using this PCR-based targeting construct (pL1740) the mutant PbΔb9Δslarp (1844cl1) was generated in mutant RMgm-934 | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |