Back to search resultsSummaryRMgm-1124
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Introduction of a transgene, Introduction of a transgene |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25073641 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA 507cl1 (RMgm-7) |
Other information parent line | P.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | Montagna, GN; Matuschewski, K |
Name Group/Department | Parasitology Unit |
Name Institute | Max Planck Institute for Infection Biology |
City | Berlin |
Country | Germany |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-1124 |
Principal name | OVA |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Not different from wild type |
Oocyst | Not different from wild type |
Sporozoite | OVA expression in sporozoites |
Liver stage | OVA expression in cytoplsm of liver stages |
Additional remarks phenotype | Mutant/mutation Other mutants |
top of page | |||||||||||||||||||
Type and details of transgene | |||||||||||||||||||
Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
Transgene name | OVA (AA 142-389) | ||||||||||||||||||
top of page | |||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||
Inducable system used | No | ||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||
Additional remarks genetic modification | To generate P. berghei parasites expressing OVA, a 747-bp fragment of chicken OVA corresponding to amino acids 142 to 389 was amplified with primers OVA_sin and OVA-_rev, using an OVA-containing plasmid as the template. The UIS4 promoter was amplified from P. berghei genomic DNA using primers UIS4_5’UTR_fd and UIS4_5’UTR_UIS4_PEXEL_reverse. To amplify a 1.1-kb fragment of the P. berghei small subunit (ssU) rRNA locus, primers PbSSU_fd and ssU_rv were used, with P. berghei genomic DNA as the template. The resulting fragments were cloned into the P. berghei transfection vector B3D+, leading to plasmid pOVA-BD3+. OVA_sin AAAAGCGGCCGCAAAAGGTAAAATGGCCAGAGAGCTCATCAAT NotI OVA_rev a CGCGGATCCGCGCTATCTAGAAGGGGAAAC BamHI UIS4_5’UTR_fd TTCCGCGGTTAATTATTATTATATCATGAAAGTAATG SacII UIS4_PEXEL_reverse ATTTGCGGCCGCTTTATTTATTCAGACGTAATAATTATGTG NotI PbSSU_fd CCCAAGCTTGGGCTGTAGCTAATACTTGTTAAG HindIII ssU_rv a GGGGTACCCCGCCGCAAGCTCCACGCCTGGTG KpnI PEXEL_fd AACCAAAAAAGCGGCCGCAAAAGGTAAAAATGAAGAAGTGTACCATTTTAG NotI PEXEL_rv CGGACTAGTCCGATCGGCAAGTAATCTGTTGACTG SpeI OVA_fv2 a CGGACTAGTCCGGCCAGAGAGCTCATCAAT SpeI | ||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||
top of page | |||||||||||||||||||
Other details transgene | |||||||||||||||||||
top of page | |||||||||||||||||||
Promoter | |||||||||||||||||||
Gene Model of Parasite | PBANKA_0501200 | ||||||||||||||||||
Gene Model P. falciparum ortholog | Not available | ||||||||||||||||||
Gene product | early transcribed membrane protein up-regulated in infective sporozoites | ||||||||||||||||||
Gene product: Alternative name | UIS4; ETRAMP10.3 | ||||||||||||||||||
| |||||||||||||||||||
top of page | |||||||||||||||||||
3'-UTR | |||||||||||||||||||
Gene Model of Parasite | Not available | ||||||||||||||||||
Gene product | Not available | ||||||||||||||||||
Gene product: Alternative name | |||||||||||||||||||
| |||||||||||||||||||
Insertion/Replacement locus | |||||||||||||||||||
Replacement / Insertion | Insertion locus | ||||||||||||||||||
Gene Model of Parasite | Not available | ||||||||||||||||||
Gene product | Not available | ||||||||||||||||||
Gene product: Alternative name | small subunit ribosomal rna gene (c- or d-type unit) | ||||||||||||||||||
| |||||||||||||||||||
top of page |
top of page | |||||||||||||||||||
Type and details of transgene | |||||||||||||||||||
Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
Transgene name | GFP (gfp-mu3) | ||||||||||||||||||
top of page | |||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||
Inducable system used | No | ||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||
Selectable marker used to select the mutant parasite | gfp (FACS) | ||||||||||||||||||
Promoter of the selectable marker | eef1a | ||||||||||||||||||
Selection (positive) procedure | FACS (flowsorting) | ||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||
Additional remarks genetic modification | |||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||
top of page | |||||||||||||||||||
Other details transgene | |||||||||||||||||||
top of page | |||||||||||||||||||
Promoter | |||||||||||||||||||
Gene Model of Parasite | PBANKA_1133300 | ||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1357100 | ||||||||||||||||||
Gene product | elongation factor 1-alpha | ||||||||||||||||||
Gene product: Alternative name | eef1a | ||||||||||||||||||
| |||||||||||||||||||
top of page | |||||||||||||||||||
3'-UTR | |||||||||||||||||||
Gene Model of Parasite | PBANKA_0719300 | ||||||||||||||||||
Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative | ||||||||||||||||||
Gene product: Alternative name | dhfr/ts | ||||||||||||||||||
| |||||||||||||||||||
Insertion/Replacement locus | |||||||||||||||||||
Replacement / Insertion | Replacement locus | ||||||||||||||||||
Gene Model of Parasite | PBANKA_0306000 | ||||||||||||||||||
Gene product | 6-cysteine protein | ||||||||||||||||||
Gene product: Alternative name | 230p | ||||||||||||||||||
| |||||||||||||||||||
top of page |