Back to search resultsSummaryRMgm-1118
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Introduction of a transgene |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25156724 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei NK65 |
Name parent line/clone | RMgm-1115 |
Other information parent line | GIMO-PbNK65 (RMgm-1115) contains as a selectable marker (SM) the fusion gene of hdhfr (human dihydrofolate reductase; positive SM) and yfcu (yeast cytosine deaminase and uridyl phosphoribosyl transferase; negative SM) stably integrated into the 230p locus (PBANKA_030600) through double cross-over recombination. The SM is under control of the P. berghei eef1α promoter. This reference line of P. berghei NK65 line is used for rapid introduction of transgenes free of drug-resistance genes (PubMed: PMID: 22216235). This GIMO mother line may have slightly increased virulence features in mice compared to the original 'NK65 Edinburg' parent line. See for more details RMgm-1115. |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | Lin JW; Janse CJ; Khan SM |
Name Group/Department | Leiden Malaria Research Group, Parasitology |
Name Institute | Leiden University Medical Centre |
City | Leiden |
Country | The Netherlands |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-1118 |
Principal name | OVA::HEP17(hep17) |
Alternative name | 2171cl1 |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | OVA::HEP17 expression at the parasitophorous vacuole membrane |
Gametocyte/Gamete | Not tested |
Fertilization and ookinete | Not tested |
Oocyst | Not tested |
Sporozoite | Not tested |
Liver stage | Not tested |
Additional remarks phenotype | Mutant/mutation The mutant has been generated and selected using the GIMO transfection method ('gene insertion/marker out') of transfection of a GIMO mother line that contains the hdhfr::yfcu selectable marker into the silent 230p locus. Evidence is presented that the location of OVA in parasites (cytosolic or at the parasitophorous vacuole membrane, PVM) influences the strength of T-cell responses. Parasites expressing OVA fused to the PVM protein HEP17 induce stronger OVA-specific T-cell responses than parasites expressing cytosolic OVA-fused to mCherry (RMgm-1112). Parasites expressing unconjugated OVA showed low levels of OVA expression, indicating that unconjugated OVA is unstable. .... Click on Ovalbumin for more rodent malaria mutants expressing OVA |
top of page | |||||||||||||||||||
Type and details of transgene | |||||||||||||||||||
Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
Transgene name | Ovalbumin (OVA ) fused to HEP17/EXP1 | ||||||||||||||||||
top of page | |||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||
Inducable system used | No | ||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||
Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||
Promoter of the selectable marker | eef1a | ||||||||||||||||||
Selection (positive) procedure | No | ||||||||||||||||||
Selection (negative) procedure | 5-fluorocytosine (5-FC) | ||||||||||||||||||
Additional remarks genetic modification | To generate a transgenic mutant with OVA fused to HEP17 (hepatocyte erythrocyte protein 17-kDa, PBANKA_092670) the DNA construct pL1884 was generated. First, the 5’ untranslated region (UTR) of hep17 (1.3 kb upstream of the start codon) and signal peptide (SP) sequence of hep17 (1—81bp) was amplified from wild type P. berghei ANKA genomic DNA using primers 6659/6660 and subcloned into the pCR2.1-TOPO vector (TOPO TA Cloning Kit, Invitrogen). Secondly, 2 pieces of DNA sequences were subsequently cloned into this vector: 1) the rest of hep17 ORF after the SP (82—726bp) along with ~700bp 3’ UTR, which was amplified using primers 6661/6662 and 2) CDS of OVA which was amplified from pENTRY201-OVA using primers 6920/6467, into sites BamHI/KpnI and NdeI/BamHI, respectively, resulting the intermediate construct encodes a protein of OVA::HEP17. Thirdly, the 5’- and 3’- targeting regions (TR) of 230p (PBANKA_030600) were amplified from wild-type P. berghei ANKA genomic DNA using primers 6838/6839 and 5587/6840 and subcloned into the above intermediate vector, using sites XhoI/EcoRI and KpnI, respectively, resulting in the final construct pL1884 (See Table below for primer sequences). This construct was linearized using SacII sites before transfection. Primers: 6467 CCGCGGATCCAGGGGAAACACATCTGCC BamHI,OVA, R 6920 GCGCAATTCCATATGATGGGCTCCATCGGTGCAG NdeI OVA, F 6659 TAAGAATGCGGCCGCTGTCAATAATATTTATTTTGGTACAC NotI 5’hep17, F 6660 GCGAATTCCATATGTTTATTTTTTCCATAAGCATTG NdeI hep17, R 6661 GCGGGATCCGGGATCGATGGTAAAACTGGCTCCAAAAATG BamHI, ClaI hep17, F 6662 CGGGGTACCATTGTTTGTGGTCATAACATAG KpnI 3’hep17, R 6838 CCCGCTCGAGCCGCGGTATATGGTAAAGAACCTACTAACAC XhoI, SacII 5'230p, F 6839 CCCGGAATTCAGGATGTGTTTTATTTGGATGTG EcoRI 5'230p, R 5587 CCGGGGTACCAATTCTCTTGAGCCCGTTAATG KpnI 3’230p, F 6840 CGGGGTACCGCGGCTATATTTTTGGTTTTATAATCTTCAC KpnI, SacII 3'230p, R | ||||||||||||||||||
Additional remarks selection procedure | This reporter mutant expressing OVA::mCherry does not contain a drug-selectable marker. The mutant has been generated in the reference line GIMOPbNK65 (RMgm-1115). The GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice. | ||||||||||||||||||
top of page | |||||||||||||||||||
Other details transgene | |||||||||||||||||||
top of page | |||||||||||||||||||
Promoter | |||||||||||||||||||
Gene Model of Parasite | PBANKA_0926700 | ||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1121600 | ||||||||||||||||||
Gene product | exported protein 1 | circumsporozoite-related antigen | parasitophorous vacuole membrane antigen QF 116 | ||||||||||||||||||
Gene product: Alternative name | HEP17; EXP1 | ||||||||||||||||||
| |||||||||||||||||||
top of page | |||||||||||||||||||
3'-UTR | |||||||||||||||||||
Gene Model of Parasite | PBANKA_0926700 | ||||||||||||||||||
Gene product | exported protein 1, putative circumsporozoite-related antigen | ||||||||||||||||||
Gene product: Alternative name | HEP17; EXP1 | ||||||||||||||||||
| |||||||||||||||||||
Insertion/Replacement locus | |||||||||||||||||||
Replacement / Insertion | Replacement locus | ||||||||||||||||||
Gene Model of Parasite | PBANKA_0306000 | ||||||||||||||||||
Gene product | 6-cysteine protein | ||||||||||||||||||
Gene product: Alternative name | 230p | ||||||||||||||||||
| |||||||||||||||||||
top of page |