RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-1106
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0302500; Gene model (P.falciparum): PF3D7_0204700; Gene product: hexose transporter (hexose transporter 1, HT1; PfHT1, PfHT, PbHT, PbHT1)
Name tag: c-myc
Phenotype Gametocyte/Gamete;
Last modified: 16 August 2014, 21:55
  *RMgm-1106
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 25124718
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherTalman AM; Sinden RE
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-1106
Principal namepHTmyc
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteBy staining male gametes with cmyc-antibodies evidence is presented that the hexose transporter (HT) is located at the plasma membrane of male gametes.
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a C-terminal c-myc(2x)-tagged version of the hexose transporter (HT)

Protein (function)
PbHT1 is a facilitative hexose transporter in the Major Facilitator Superfamily of integral membrane proteins that mediates the uptake of glucose and fructose by the parasite. HT1 of P. falciparum is known to transport glucose and fructose and is essential for blood stage parasites. See also the mutants with search term 'hexose transporter'.

Phenotype
By staining male gametes with cmyc-antibodies evidence is presented that the hexose transporter (HT) is located at the plasma membrane of male gametes.

Additional information
The paper describes a proteome analysis of P. berghei male gametes.
615 proteins were recovered,amongst them the 11 enzymes of the glycolytic pathway. The hexose transporter was localized to the gamete plasma membrane and evidence is presented that microgamete motility can be suppressed effectively by inhibitors of this transporter and of the glycolytic pathway.

Other mutants
See also the mutants with search term 'hexose transporter'.


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0302500
Gene Model P. falciparum ortholog PF3D7_0204700
Gene producthexose transporter
Gene product: Alternative namehexose transporter 1, HT1; PfHT1, PfHT, PbHT, PbHT1
Details of the genetic modification
Name of the tagc-myc
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/construct(Linear) plasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationOne-thousand and thirty bp of the P. berghei hexose transporter gene (PBANKA_030250) were amplified in a two-step PCR to insert an EcoRV linearization site for subsequent transfection. AdvantageII Taq polymerase (Takara Bioscience) was used for all amplifications. Primers F (GGGGTACCTGGTGTATTGCATCAGTTAT, KpnI site in italics) and MR (GAAAACCTGATATCATACATCCT) as well as MF (AGGATGTATGATATCAGGTTTTC, EcoRV site in italics) and R (TTGGGCCCAACTCTTGATTTGCTTATATGTT, ApaI site in italics) were used for the first PCR. The products of these PCRs were then used as templates for the second PCR with primers F and R. The resulting fragment was inserted into vector p0007 (courtesy of J D Raine) to produce pHTmyc. This plasmid contains the hexose transporter homology region; two c-myc tags followed by the 3′UTR from P. berghei dhfr and the Toxoplasma gondii dhfr/ts resistance cassette.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6