RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-38
Malaria parasiteP. yoelii
Genotype
DisruptedGene model (rodent): PY17X_0502200; Gene model (P.falciparum): PF3D7_1016900; Gene product: early transcribed membrane protein 10.3 | protein of early gametocyte 4 (UIS4, up-regulated in infective sporozoites, ETRAMP10.3)
Phenotype Liver stage;
Last modified: 16 September 2015, 18:44
  *RMgm-38
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 17624848
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone Not applicable
Other information parent line17XNL is a non-lethal strain of P. yoelii
top of page
The mutant parasite was generated by
Name PI/ResearcherA.S. Tarun, S.H.I. Kappe
Name Group/DepartmentDepartment of Pathobiology
Name InstituteUniversity of Washington
CitySeattle
CountryUSA
top of page
Name of the mutant parasite
RMgm numberRMgm-38
Principal namePyuis4[-]
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageIn vitro invasion of hepatocytes by the sporozoites is not affected. Liver stage development is strongly impaired. In vivo (BALB/c mice), the number of liver stages at 2 hours after intravenous injection of sporozoites is reduced by 60%. The number of liver stages at 24h were reduced by >95%. liver stages could not be detected at 40h after infection. Liver stages were morphologically similar to wt liver stages at 6 and 12h after infection, a time when the intrahepatocytic transformation from elongate sporozoite to spherical trophozoites commences. Antibody staining for HEP17, a parasitophorous vacuole membrane (PVM)protein, showed a typical circumferential pattern, which indicates that the PVM is present. Liver stages did not develop into schizonts but appeared to be arrested at the trophozoite stage. Arrested liver stages did not persist in the liver after 40h.
Infection of BALB/c mice by intravenous inoculation of high numbers of sporozoites (50.000) did not result in blood stage infection.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of the UIS4 protein ('up-regulated in infective sporozoites').

Protein (function)
UIS4 has been identified by transcription-profiling of sporozoites (Kaiser et al., (2001). Mol. Microbiol. 51, 1221-32). The protein is expressed throughout liver stage development and localizes to the parasitophorous vacuole.

Phenotype
The phenotype analysis demonstates an essential role of this protein in liver stage development. 

Additional information
A P. berghei mutant has been generated that lacks the expression of this protein (RMgm-35). This mutant shows the same phenotype as described above. P. berghei and P. yoelii  'attenuated sporozoites' lacking expression of UIS4 can induce sterile (protective) immunity in mice against challenge with wild type sporozoites by immunization of mice (C57Bl/6) with the mutant sporozoites.

Other mutants
A P. berghei mutant has been generated that lacks the expression of this protein (RMgm-35).
A. P. berghei mutant has been generated that lacks the expression of not only UIS4 but also UIS3 (PB000892.03.0; RMgm-39).

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PY17X_0502200
Gene Model P. falciparum ortholog PF3D7_1016900
Gene productearly transcribed membrane protein 10.3 | protein of early gametocyte 4
Gene product: Alternative nameUIS4, up-regulated in infective sporozoites, ETRAMP10.3
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCTGGATTCATTTTTTGAT
Additional information primer 1PY4REP1F
Sequence Primer 2CGGGAAGCTTTTATTCAGATGTAAT
Additional information primer 2PY4REP2R
Sequence Primer 3GGGAATTCATATAATTCATTATGAGGGTAATTCAG
Additional information primer 3PY4REP3F
Sequence Primer 4GGGGATCCAGGTTTGCATATACGG
Additional information primer 4PY4REP4R
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren