RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-995
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_0614300; Gene model (P.falciparum): PF3D7_0716600; Gene product: cysteine desulfurase (SufS)
PhenotypeNo phenotype has been described
Last modified: 9 March 2014, 19:38
  *RMgm-995
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Reference 1 (PMID number) : 24586983
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherHaussig, J.M.; Kooij, T.W.A.
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0614300
Gene Model P. falciparum ortholog PF3D7_0716600
Gene productcysteine desulfurase
Gene product: Alternative nameSufS
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationAn intermediate pBAT-derived vector was used (see RMgm-757)
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TTTCCGCGGGATTTTGCCTTTTTCAAGAATATGG
Additional information primer 1TV-5'SUFS-F
Sequence Primer 2ATAGATATCCTCATTATTCATATTCCCACAAATTTG
Additional information primer 2TV-5'SUFS-R
Sequence Primer 3AAAAAGCTTATCATTTGTGTGTGCTCATACG
Additional information primer 3TV-3'SUFS-F
Sequence Primer 4AAAGGTACCATTCTCCATGCAAAGCAAAAATAC
Additional information primer 4TV-3'SUFS-R
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: StudioDrie StudioDrie; S. Mededovic and A. van Wigcheren