RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-970
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0813000; Gene model (P.falciparum): PF3D7_0911900; Gene product: falstatin | inhibitor of cysteine proteases (falstatin; PbICP; ICP)
Phenotype Sporozoite; Liver stage;
Last modified: 14 December 2013, 23:01
  *RMgm-970
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 24281719
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent lineTwo mutants are generated; one in wild type ANKA parasites and one in a GFP-expressing reference line (RMgm-7).
The mutant parasite was generated by
Name PI/ResearcherK. E. Boysen; K. Matuschewski
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-970
Principal nameicp(-); icp(-)-GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot different from wild type
SporozoiteOnly 'hemocoel-associated' sporozoites are formed. Sporozoites do not invade salivary glands. Hemocoel sporozoites show reduced gliding. Sporozoites are not infectious to hepatocytes in culture.
Liver stageSporozoites are not infectious to hepatocytes in culture and not infectious to mice (after intravenous inoculation of hemocoel sporozoites)
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of ICP.
Two mutants are generated; one in wild type ANKA parasites and one in a GFP-expressing reference line (RMgm-7). In this line GFP is expressed from the constitutive eef1a promoter. In the first mutant GFP is present in the icp disruption vector resulting in expression of GFP under the promoter region of icp.

Protein (function)
An endogenous cysteine protease inhibitor has been identified in P. falciparum, Pf-ICP (PF3D7_0911900; Falstatin). A recombinant  Pf-ICP expressed in E. coli was shown to potently inhibit a number of host proteases by in vitro protease activity assays. Additionally, Pf-ICP also inhibited several parasite proteases in these assays, including falcipain-2 and falcipain-3, but not falcipain-1. Search the database with the P. falciparum icp gene model PF3D7_0911900 for additional mutants expressing tagged forms of ICP in rodent parasites

Phenotype
Evidence is presented that disruption of icp does not affect blood stage virulence or growth of asexual blood stages.
Mutants show normal oocyst production indicating the lack of an effect of icp disruption on gametocyte production/fertility and ookinete formation.
Only 'hemocoel-associated' sporozoites are formed. Sporozoites do not invade salivary glands. Hemocoel sporozoites show reduced gliding. Sporozoites are not infectious to hepatocytes in culture.

Additional information
Previous attempts to disrupt the icp gene were unsuccesfull. See  RMgm-245, RMgm-397 and RMgm-844 for unsuccessful attempts to disrupt the P. berghei icp gene. Search the database with the P. falciparum icp gene model PF3D7_0911900 for additional mutants expressing tagged forms of ICP.

Evidence is presented for enhanced cleavage of CSP and it is proposed that ICP regulates the cysteine protease-dependent processing of CSP,

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0813000
Gene Model P. falciparum ortholog PF3D7_0911900
Gene productfalstatin | inhibitor of cysteine proteases
Gene product: Alternative namefalstatin; PbICP; ICP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ttgaattcatgctccatcctag
Additional information primer 15’ KO flank for
Sequence Primer 2acatatgtatgtcgttatctgagc
Additional information primer 25’ KO flank rev
Sequence Primer 3accgcatacaagcttg
Additional information primer 33’ KO flank for
Sequence Primer 4tggtaccgcaacaatag
Additional information primer 43’ KO flank rev
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6