RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-960
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0416500; Gene model (P.falciparum): PF3D7_0904900; Gene product: copper-transporting ATPase (CuTP)
Transgene
Transgene not Plasmodium: GFP
Promoter: Gene model: PBANKA_0711900; Gene model (P.falciparum): PF3D7_0818900; Gene product: heat shock protein 70 (HSP70)
3'UTR: Gene model: PBANKA_1340000; Gene product: dihydrofolate synthase/folylpolyglutamate synthase, putative (Dhfs-fpgs)
Replacement locus: Gene model: PBANKA_0416500; Gene product: copper-transporting ATPase
Phenotype Asexual bloodstage; Gametocyte/Gamete; Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 27 July 2015, 18:44
  *RMgm-960
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 24237419
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherS, Kenthirapalan; T.W. Kooij
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-960
Principal namecutp(–)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageThe course of infections was similar to wild type parasites. Slightly reduced schizont maturation in in vitro cultures.
Gametocyte/GameteNormal production of mature male and female gametocytes. Strongly reduced (85-90%) formation of male gametes (exflagellation)
Fertilization and ookineteNormal production of mature male and female gametocytes. Strongly reduced (85-90%) formation of male gametes (exflagellation). Frmale fertility strongly reduced. Ookinete formation strongly reduced (~99%)
OocystOokinete and oocyst formation strongly reduced (~99%)
SporozoiteOokinete,oocyst and sporozoite formation strongly reduced (95-99%)
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of PBANKA_041650 (copper-transporting ATPase, putative; CuTP) and expresses GFP under the control of the constitutive hsp70 promoter.

Protein (function)
Copper serves as a cofactor in metalloenzymes and catalyzes electron transfer reactions as well as the generation of potentially toxic reactive oxygen species.
Plasmodium species harbor at least three genes, which are predicted to be involved in copper transport and the maintenance of copper homeostasis: two proteins harboring a putative Ctr copper transporter domain (Pfam04145; PBANKA_102150 and PBANKA_130290) and one copper-transporting P-type ATPase (CuTP; PBANKA_041650).

Phenotype
Phenotype analyses indicate a strongly reduced fertility of male and female gametocytes/gametes of parasites lacking PBANKA_041650 (copper-transporting ATPase, putative) . The protein has a dispensable role during asexual blood stage growth/multiplication.

Additional information
Crossing experiments of mutant female gametes with wild type male gametocytes indicate reduced fertility of mutant female gametes (in addition to reduced male gamete formation of mutant parasites).

Analyses of a mutant expressing a a C-terminal mCherry-3xMyc-tagged version of CuTP (RMgm-961) demonstrated that CuTP is predominantly located in vesicular bodies in the cytoplasm of the parasite.

Other mutants
RMgm-961: A mutant expressing a C-terminal mCherry-3xMyc-tagged version of PBANKA_041650 (copper-transporting ATPase, putative)


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0416500
Gene Model P. falciparum ortholog PF3D7_0904900
Gene productcopper-transporting ATPase
Gene product: Alternative nameCuTP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AAACCGCGGGAACTATTTCTCCGTATAACAGG
Additional information primer 1CuTP-F2-SacII
Sequence Primer 2AAAGAATTCTTAATTAATATAATATATGTTCATACACTAATATGACCC
Additional information primer 2CuTP-R1-EcoRI
Sequence Primer 3AATCCTAGGCGCTTTGCCAAATTTCATTTTATC
Additional information primer 3CuTP-F5-AvrII
Sequence Primer 4ATAGGTACCACTATGTATGTGCGCATTATTTTC
Additional information primer 4CuTP-R4-KpnI
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0711900
Gene Model P. falciparum ortholog PF3D7_0818900
Gene productheat shock protein 70
Gene product: Alternative nameHSP70
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_1340000
Gene productdihydrofolate synthase/folylpolyglutamate synthase, putative
Gene product: Alternative nameDhfs-fpgs
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0416500
Gene productcopper-transporting ATPase
Gene product: Alternative name
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4