RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-945
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_0931200; Gene model (P.falciparum): PF3D7_1116800; Gene product: heat shock protein 101 | chaperone protein ClpB2 (HSP101)
PhenotypeNo phenotype has been described
Last modified: 1 October 2013, 12:40
  *RMgm-945
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Reference 1 (PMID number) : 24076174
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherTWA. Kooij: JM Matz
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0931200
Gene Model P. falciparum ortholog PF3D7_1116800
Gene productheat shock protein 101 | chaperone protein ClpB2
Gene product: Alternative nameHSP101
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe unsuccessful attempts to disrupt the hsp101 gene indicates an essential role of HSP101 in blood stages.

Plasmodium parasites remodel their vertebrate host cells by translocating hundreds of proteins across an encasing membrane into the host cell cytosol via a putative export machinery termed PTEX (Plasmodium Translocon of EXported protein). HSP101 (PbANKA_094120), PTEX150 (PbANKA_100850), EXP2 (PbANKA_133430), PTEX88 (PbANKA_094130) and TRX2 (PbANKA_135800) have been identified as members of the PTEX complex.
In this study HSP101, PTEX150, EXP2 could not be genetically deleted in P. berghei. In contrast, the putative thioredoxin-like protein TRX2 and PTEX88 could be deleted.

The standard pBAT vector was used to generate the gene deletion constructs. This vector contains: (i) a drug-selectable cassette, (ii) a high expressing GFP cassette, (iii) a C-terminal red fluorescent (mCherry) and triple epitope (3xMyc) tag, (iv) two extensive multiple cloning sites (see RMgmDB-757 for details of this vector). The 3' fragment of the target gene was amplified from gDNA using XhoI and KpnI to generate the intermediate construct pPTEX-IM. The 5' promoter region of the target gene was amplified from ANKA gDNA and fused directly upstream of the mCherry-3xMyc tag in the pPTEX-IM vector using SacII and HpaI.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AGTACCCCGCGGATAAATAGAATAAGATGCTTGCTTTCG
Additional information primer 15'HSP101-F-SacII
Sequence Primer 2ATCAGGGTTAACTAAATTTATAGTAAATATAGATATAATTTTATCTTCATTC
Additional information primer 25'HSP101-R-HpaI
Sequence Primer 3AGATGTCTCGAGTTAAATAAAACAAACACGATATGTTGCATG
Additional information primer 33'HSP101-F-XhoI
Sequence Primer 4TTACTTGGTACCTTATTATCACACACTTTTTCATAGATATTGC
Additional information primer 43'HSP101-R-KpnI
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6