RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-942
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0941300; Gene model (P.falciparum): PF3D7_1105600; Gene product: translocon component PTEX88
Transgene
Transgene not Plasmodium: mCherry
Promoter: Gene model: PBANKA_0941300; Gene model (P.falciparum): PF3D7_1105600; Gene product: translocon component PTEX88
3'UTR: Gene model: PBANKA_1426700; Gene product: dihydropteroate synthetase, putative (DHPS; PPPK)
Replacement locus: Gene model: PBANKA_0941300; Gene product: translocon component PTEX88
Transgene
Transgene not Plasmodium: GFP
Promoter: Gene model: PBANKA_0711900; Gene model (P.falciparum): PF3D7_0818900; Gene product: heat shock protein 70 (HSP70)
3'UTR: Gene model: PBANKA_1340000; Gene product: dihydrofolate synthase/folylpolyglutamate synthase, putative (Dhfs-fpgs)
Insertion locus: Gene model: PBANKA_0941300; Gene product: translocon component PTEX88
Phenotype Asexual bloodstage;
Last modified: 27 July 2015, 18:40
  *RMgm-942
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 24076174
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherTWA. Kooij: JM Matz
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-942
Principal nameptex88(–)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageReduced (50%) asexual multiplication/growth rate
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot tested
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of PTEX88 and expresses mCherry under the control of the PTEX88 promoter and GFP under the control of the HSP70 promoter

Protein (function)
Plasmodium parasites remodel their vertebrate host cells by translocating hundreds of proteins across an encasing membrane into the host cell cytosol via a putative export machinery termed PTEX (Plasmodium Translocon of EXported protein). HSP101 (PbANKA_094120), PTEX150 (PbANKA_100850), EXP2 (PbANKA_133430), PTEX88 (PbANKA_094130) and TRX2 (PbANKA_135800) have been identified as members of the PTEX complex.
In this study HSP101, PTEX150, EXP2 could not be genetically deleted in P. berghei. In contrast, the putative thioredoxin-like protein TRX2 and PTEX88 could be deleted.

Phenotype
Reduced (50%) asexual multiplication/growth rate.
The mutant showed normal oocyst and sporozoite production and normal liver stage development in cultured hepatocytes. No details are provided on the analysis of mosquito and liver stages.

Additional information
The standard pBAT vector was used to generate the gene deletion constructs. This vector contains: (i) a drug-selectable cassette, (ii) a high expressing GFP cassette, (iii) a C-terminal red fluorescent (mCherry) and triple epitope (3xMyc) tag, (iv) two extensive multiple cloning sites (see RMgm-757 for details of this vector). The 3' fragment of PTEX88 was amplified from gDNA  using XhoI and KpnI to generate the intermediate construct pPTEX-IM. The 5' promoter region of PTEX88 was amplified from ANKA gDNA  and fused directly upstream of the mCherry-3xMyc  tag in the  pPTEX-IM vector using SacII and HpaI.

Other mutants
See RMgm-917 for unsuccessful attempts to disrupt P. berghei PTEX88


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0941300
Gene Model P. falciparum ortholog PF3D7_1105600
Gene producttranslocon component PTEX88
Gene product: Alternative name
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe standard pBAT vector was used to generate the gene deletion constructs. This vector contains: (i) a drug-selectable cassette, (ii) a high expressing GFP cassette, (iii) a C-terminal red fluorescent (mCherry) and triple epitope (3xMyc) tag, (iv) two extensive multiple cloning sites (see RMgmDB-757 for details of this vector). The 3' fragment of PTEX88 was amplified from gDNA using XhoI and KpnI to generate the intermediate construct pPTEX-IM. The 5' promoter region of PTEX88 was amplified from ANKA gDNA and fused directly upstream of the mCherry-3xMyc tag in the pPTEX-IM vector using SacII and HpaI.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ACGATACCGCGGGCATAAAGGCTATTGCGGCTA
Additional information primer 15'PTEX88-F-SacII
Sequence Primer 2TACGTCGTTAACTCGAATTTTGGGGATTTCAATCTTTTTAAG
Additional information primer 25'PTEX88-R-HpaI
Sequence Primer 3GTCCTTCTCGAGTTTAGAAAACCCAAATCAACGTACTGG
Additional information primer 33'PTEX88-F-XhoI
Sequence Primer 4GTGTACGGTACCGGCATCAAGATGCGTGGAGA
Additional information primer 43'PTEX88-R-KpnI
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene namemCherry
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe standard pBAT vector was used to generate the gene deletion constructs. This vector contains: (i) a drug-selectable cassette, (ii) a high expressing GFP cassette, (iii) a C-terminal red fluorescent (mCherry) and triple epitope (3xMyc) tag, (iv) two extensive multiple cloning sites (see RMgmDB-757 for details of this vector). The 3' fragment of PTEX88 was amplified from gDNA using XhoI and KpnI to generate the intermediate construct pPTEX-IM. The 5' promoter region of PTEX88 was amplified from ANKA gDNA and fused directly upstream of the mCherry-3xMyc tag in the pPTEX-IM vector using SacII and HpaI.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0941300
Gene Model P. falciparum ortholog PF3D7_1105600
Gene producttranslocon component PTEX88
Gene product: Alternative name
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_1426700
Gene productdihydropteroate synthetase, putative
Gene product: Alternative nameDHPS; PPPK
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0941300
Gene producttranslocon component PTEX88
Gene product: Alternative name
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe standard pBAT vector was used to generate the gene deletion constructs. This vector contains: (i) a drug-selectable cassette, (ii) a high expressing GFP cassette, (iii) a C-terminal red fluorescent (mCherry) and triple epitope (3xMyc) tag, (iv) two extensive multiple cloning sites (see RMgmDB-757 for details of this vector). The 3' fragment of PTEX88 was amplified from gDNA using XhoI and KpnI to generate the intermediate construct pPTEX-IM. The 5' promoter region of PTEX88 was amplified from ANKA gDNA and fused directly upstream of the mCherry-3xMyc tag in the pPTEX-IM vector using SacII and HpaI.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0711900
Gene Model P. falciparum ortholog PF3D7_0818900
Gene productheat shock protein 70
Gene product: Alternative nameHSP70
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_1340000
Gene productdihydrofolate synthase/folylpolyglutamate synthase, putative
Gene product: Alternative nameDhfs-fpgs
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite PBANKA_0941300
Gene producttranslocon component PTEX88
Gene product: Alternative name
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4