top of page |
Type and details of transgene |
Is the transgene Plasmodium derived |
Transgene: not Plasmodium |
Transgene name | mCherry |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct | Plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Selectable marker used to select the mutant parasite | tgdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | To generate a vector that introduces mCherry into the P.c. chabaudi SSu-rRNA locus on chromosomes 5, the Pl0017 plasmid vector (Franke-Fayard, B. et al. 2004; Mol. Biochem. Parasitol. 137, 23–33) was modified as follows: (i) A KpnI-ApaI fragment of the P. berghei SSu-rRNA target region of pL0017 was excised and replaced with the corresponding 704-bp region of P.c. chabaudi chromosome 5 SSu-rRNA that was amplified from Pcc AS genomic DNA using the primers; GACTGGTACCAGTAGTCATATGCTTGTCTC and CAATGGGCCCTATAGTTAAAAGTACGACGAGGC (restriction sites underlined); (ii) The BamH1-Not1 fragment of PF0017 encoding green fluorescent protein was excised and replaced with mCherry. |
Additional remarks selection procedure | |
top of page |
Other details transgene |
top of page |
Promoter |
Gene Model of Parasite |
PBANKA_1133300
|
Gene Model P. falciparum ortholog |
PF3D7_1357100
|
Gene product | elongation factor 1-alpha |
Gene product: Alternative name | eef1a |
Primer information details of the primers used for amplification of the promoter sequence
Primer information details of the primers used for amplification of the promoter sequence
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
top of page |
3'-UTR |
Gene Model of Parasite |
PBANKA_0719300
|
Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative |
Gene product: Alternative name | dhfr/ts |
Primer information details of the primers used for amplification the 3'-UTR sequences
Primer information details of the primers used for amplification the 3'-UTR sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
Insertion/Replacement locus |
Replacement / Insertion | Insertion locus |
Gene Model of Parasite |
Not available
|
Gene product | Not available |
Gene product: Alternative name | small subunit (ssu) ribosomal RNA locus |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
|
|
top of page |