RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-938
Malaria parasiteP. berghei
Genotype
Transgene
 Transgene not Plasmodium: mCherry
Promoter: Gene model: PBANKA_0711900; Gene model (P.falciparum): PF3D7_0818900; Gene product: heat shock protein 70 (HSP70; HSP70/1)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Insertion locus: Gene model: PBANKA_0711900; Gene product: heat shock protein 70 (HSP70; HSP70/1)
Phenotype Asexual bloodstage; Gametocyte/Gamete; Oocyst; Sporozoite; Liver stage;
Last modified: 14 September 2013, 22:44
  *RMgm-938
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 24013507
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherHliscs, M; Matuschewski, K.
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
top of page
Name of the mutant parasite
RMgm numberRMgm-938
Principal namePbred cANKA
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stagemCherry expression in blood stages
Gametocyte/GametemCherry expression in gametocytes
Fertilization and ookineteNot tested
OocystmCherry expression in oocysts
SporozoitemCherry expression in sporozoites
Liver stagemCherry expression in liver stages
Additional remarks phenotype

Mutant/mutation
The mutant contains the mCherry gene under the control of the hsp70/1 promoter integrated into the hsp70/1 locus by single cross-over recombination. The integration event results in the presence of a functional copy of the hsp70/1 locus next to the transgene cassette.

Protein (function)

Phenotype
Strong mCherry expression in all life cycle stages. The phenotype of the transgenic parasite was comparable to wild type throughout the complete life cycle indicating that mCherry expression had no negative effect on growth/development.

Additional information


Other mutants

  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene namemCherry
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationAn HSP70/1 5' region of 2,220 bp was selected as promoter sequence and amplified from gDNA using primers HSP70_for (GCGAATTCAATGAGTGAATATGACTTTCATTCG) and HSP70_rev (GGGGATCCCATGTTTTTTTAATTGTAATTGTAATTTA TTGGG). The resulting fragment was cloned via EcoRI and BamHI restriction sites into a P. berghei targeting plasmid, termed pSE61 (kindly provided by Dr. Sabine Engelmann). Subsequently, mCherry was amplified from the plasmid B3D+mCherry [10] using primers mCherry_for-BamHI and mCherry_rev_SpeI and cloned via BamHI and SpeI downstream of the 5' promoter sequence. mCherry transcript stability was facilitated by cloning of the 3'UTR of P. berghei dihydrofolate reductase/thymidylate synthase (DHFR/TS) downstream of mCherry. The final plasmid, pHSP70/1::mCherry, was used for P. berghei transfection.
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_0711900
Gene Model P. falciparum ortholog PF3D7_0818900
Gene productheat shock protein 70
Gene product: Alternative nameHSP70; HSP70/1
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite PBANKA_0711900
Gene productheat shock protein 70
Gene product: Alternative nameHSP70; HSP70/1
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: StudioDrie StudioDrie; S. Mededovic and A. van Wigcheren